While studying the structure of a small gene that was sequenced during the Human Genome Project, an investigator notices that one strand of the DNA molecule contains 20 As, 25 Gs, 30 Cs, and 22 Ts. How many of each base is found in the complete double-stranded molecule? A. A = 40, G = 50, C = 60, T = 44 B. A = 44, G = 60, C = 50, T = 40 C. A = 45, G = 45, C = 52, T = 52 D. A = 50, G = 47, C = 50, T = 47 E. A = 42, G = 55, C = 55, T = 42

While studying the structure of a small gene that was sequenced during the Human Genome Project, an investigator notices that one strand of the DNA molecule contains 20 As, 25 Gs, 30 Cs, and 22 Ts. How many of each base is found in the complete double-stranded molecule? A. A = 40, G = 50, C = 60, T = 44 B. A = 44, G = 60, C = 50, T = 40 C. A = 45, G = 45, C = 52, T = 52 D. A = 50, G = 47, C = 50, T = 47 E. A = 42, G = 55, C = 55, T = 42

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
In the Watson-Crick structure of DNA, the: a. adenine content of one strand must equal the thymine content of the same strand. b. nucleotides are arranged in the A-form. c. purine content (fraction of bases that are purines) must be the same in both strands. d. two strands are parallel. e. the strands are complementary to each other.
A researcher sequences the genome of a variety of bacterial and eukaryotic cells. She finds that the bacterial genome is smaller, but that there are more genes for a given number of base pairs in the eukaryotic cells. In other words, there are fewer genes per unit of length of DNA in the eukaryotic cells. What do you predict she will find if she examines the DNA more closely? A. All of the bacterial DNA consists of coding sequences, but this is not true of the eukaryotic DNA. B. There are more repetitive sequences in the eukaryotic DNA than in the bacterial DNA. C. There are densely packed genes in the eukaryotic DNA that were not immediately distinguishable during the first analysis. D. The bacteria have larger quantities of noncoding DNA than the eukaryotic cells.
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
Back in the 1950s, the techniques for isolating DNA from cells all yielded molecules of about 10,000 to 20,000 base pairs. We now know that the DNA molecules in all cells are much longer. Why do you suppose such short pieces were originally isolated? Explain your answer in 1-2 sentences.
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
Draw the structure of deoxyribose and number the carbon atoms.Describe the numbering of the carbon atoms in deoxyribose withregard to the directionality of a DNA strand. In a DNA doublehelix, what does the term antiparallel mean?
in the DNA of certain bacterial cells, 13% of the nucleotides are adenine. What are the percentages of the other nucleotides?
The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following question: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain b) Could methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove? Explain your answer.
Which of the following feature/s characterize B-form DNA? I. Two antiparallel, polynucleoside chains are coiled in a helix around a common axis. II. The purine and pyrimidine bases lie on the inside of the helix. III. The pairing of bases follows Chargaff's rules such that A pairs with U and G pairs with C. IV. B-DNA has a longer helical pitch compared to Z-DNA. O Ill only O Il only O l and II O Il and III O None are correct O , II, and II O l only
Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?