Which of the following feature/s characterize B-form DNA? I. Two antiparallel, polynucleoside chains are coiled in a helix around a common axis. II. The purine and pyrimidine bases lie on the inside of the helix. III. The pairing of bases follows Chargaff's rules such that A pairs with U and G pairs with C. IV. B-DNA has a longer helical pitch compared to Z-DNA. O Il only O Il only O l and I O Il and III O None are correct O I, II, and II O l only
Q: Draw a stylized diagram of double-stranded DNA. Use a pentagon for sugar, a circle for phosphate and…
A: DNA STRUCTURE:- DNA structure is given by Watson and Crick, who proposed the double-helical…
Q: If the sequence of bases in one strand of DNA is 5′ TAGCCT 3′,then the sequence of bases in the…
A: Answer is c.) 3'ATCGGA5'.
Q: The base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T,…
A: Most organisms contain DNA or deoxyribonucleic acid as their genetic material. It is a type of…
Q: Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: Which of the following statements is not true? Explain why. A. A DNA strand can serve as a template…
A: DNA is deoxyribonucleic acid. The nucleic acids are the building blocks of DNA molecules. DNA is a…
Q: In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in…
A: The DNA double helix model is generally one of the best discoveries of the 20th century. DNA is…
Q: A key difference between B DNA and Z DNA is thata. B DNA is right-handed, whereas Z DNA is…
A: DNA is the molecule which carries the genetic information of the cell. It is a long biopolymer of…
Q: Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT TA…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…
Q: Suppose the following base sequence was found in a 20-base DNA polymer. 3'СAGTTAC…
A: DNA, or deoxyribonucleic acid, is a biomacromolecule that is responsible for the transmission of…
Q: Which of the following represents a missense mutation in the DNA coding strand sequence, 5' -…
A: A change in the structure of DNA, known as a mutation, can alter the sequence of amino acids that…
Q: You have created a synthetic nucleotide, nucleotide X, which can be substituted into a DNA strand…
A: Introduction A nucleoside and a phosphate make up nucleotides, which are organic compounds. They…
Q: Which of these statements is correct regarding the complimentary sequence to this DNA strand: 5' -…
A: Nucleotide are elemental unit that forms genetic material that is DNA and RNA . It consists of :- I…
Q: Given the following strand of DNA: 5' CATAGCCTTA 3' Which of the following sequences is the…
A: DNA and RNA are nucleic acids present in organisms. DNA is the deoxyribose nucleic acid whereas RNA…
Q: What is the contribution of Van der Waals forces in the stability of the DNA the double helix…
A: Introduction: DNA is a hereditary material present in the living cell. James Watson and Francis…
Q: Give the complimentary DNA strand for the following: ACG TAG CTA GTC AGT CGT AGC Give the RNA…
A: NOTE:- Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: "Chargaff's rules" about the composition of bases in DNA dictates that A. the sum of purine…
A: Chargaff's rules explain the structure and composition of DNA. Chargaff's rules include the…
Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…
A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…
Q: Which of the following changes occur with a double-stranded DNA if it is heated to 95°C at neutral…
A: The hereditary substance found in practically all species is DNA or deoxyribonucleic acid. DNA aids…
Q: 1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the…
A: I Double stranded DNA the base pairing between the strands occurs as follows: A pairs with T and G…
Q: If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and…
A: Given: A piece of the partially double-stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA…
Q: The Watson and Crick model of DNA structure shows the following EXCEPT A the turn of the DNA helix…
A: Watson and Crick proposed a specific DNA structure called the 3-dimensional DNA. DNA is comprised of…
Q: Identify the statements that describe the structure of DNA. (select all that are correct) A. A DNA…
A: Deoxyribose Nucleic Acid (DNA) and Ribo Nucleic Acid (RNA) have incredible concoction similitudes.…
Q: A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following…
A: Multiple copies of DNA copies can be achieved with the polymerase chain reaction in large amounts of…
Q: Which of the following statements is (are) true? (a) The two strands of DNA run parallel from their…
A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…
Q: Enzymes that break down DNA catalyze the hydrolysis of the covalent bonds that join nucleotides…
A: DNA stands for deoxyribonucleic acid. It consists of deoxyribonucleotides.
Q: The helix of an A-DNA differs from the helix of a B-DNA in all of the following EXCEPT which phrase?…
A: DNA (deoxyribonucleic acid) is a type of nucleic acid, which acts as the genetic material. A-DNA,…
Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…
A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…
Q: One strand of a double-helical DNA has the sequence (5′)GCGCAATATTTCTCAAAATATTGCGC(3′). Write the…
A: The complementary strand is (5')GCGCAATATTTTGAGAAATATTGCGC(3') (sequence of a single strand is…
Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with…
A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple…
Q: The single strand of DNA below forms a stem-loop structure structure with a loop that is 6…
A: The answer will be b) 5' CTACGATA 3' As in this option 5 nucleotides from 3' end are complimentary…
Q: Given the DNA sequence; 3’-GCTACGTCGC-5’ 5’-CGATGCAGCG-3’ What is the total number of hydrogen…
A: Hydrogen bonds: The electrostatic force of attraction which involves Hydrogen atom.
Q: Which of the following is true about the structure of DNA as proposed by Watson and Crick (B-form…
A: Introduction: Nucleic acids are large complex biomolecules that store hereditary information…
Q: Draw the structure of deoxyribose and number the carbon atoms.Describe the numbering of the carbon…
A: The DNA (deoxyribonucleic acid) is the hereditary unit of all living organisms. It consists of…
Q: Which of the following is not a feature of the DNA double helix?a. It obeys the AT/GC rule.b. The…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: Which statement about DNA bases is true? A. Adenine and guanine are purines. B. Thymine and…
A: A nucleotide is the basic building block of nucleic acids. Ribonucleic acid (RNA) and…
Q: the contribution of Rosalind Franklin to the discovery of DNA's structure
A: To find The contribution of Rosalind Franklin to the discovery of DNA's structure
Q: One strand of a DNA molecule has the base sequence 5’-CACTTA-3’. The complementary base sequence on…
A: Deoxyribonucleic acid (DNA) is defined as an organic chemical molecule that will contain all the…
Q: For entertainment on a Friday night, a genetics professor proposed that his children diagram a…
A: DNA Is a Polynucleotide. DNA is composed of nucleotides strung together to make a long chain called…
Q: Which statement about nonpolar interactions in the formation of the DNA double helix is INCORRECT?…
A: Deoxyribose Nucleic Acid (DNA) is a nucleic acid that acts as the genetic material in all organisms…
Q: For entertainment on a Friday night, a genetics professor proposed that his children diagram a…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: State the properties of the Watson-Crick model of DNA in the following categories: a) number of…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: Which statement correctly explains the chemical basis of Chargaff's rules? Specific purines and…
A: Chargaff’s rules state that in double-stranded DNA, the number of A nucleotide is always equal to…
Q: Draw the full structure of the DNA strand: 5'-ATG-3' To the above strand, draw the complementary…
A: Nucleic acid are the macromolecules which are of two types :- DNA and RNA DNA is deoxyribonucleic…
Q: tate Chargaff’s rules. How did these rules help to discern the structure of DNA?
A: There are two types of nucleic acids, deoxyribonucleic acid or DNA and ribonucleic acid or RNA. Both…
Q: H H H.
A: The genetic material in all organisms is DNA where RNA is found in viruses as genetic material.…
Q: , Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…
A: Note- According to the guidelines, we are supposed to solve first three subparts (a, b and c) of a…
Q: What was the contribution of Rosalind Franklin to the discovery of DNA's structure? a.Discovery…
A: DNA is that the chemical name for the molecule that carries genetic directions altogether living…
Q: Which of the following statements is true for double-stranded DNA? O All of the given choices are…
A: All cellular lifeforms have DNA as their genetic material. A double stranded DNA (dsDNA) is composed…
Step by step
Solved in 3 steps
- The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’Which of the following does NOT describe DNA as it occurs in Eukaryotic cells. CHOOSE ALL THAT APPLY: 1. nitrogenous bases of opposite strands are paired through covalent bonds 2. base pairs are stacked 3.4 A (0.34 nm) apart 3. the two strands of one double helix are complementary 4. two long polynucleotide chains 5. there are 20 base pairs per each turn of a double helix 6. adenine pairs with thymine of the neighboring nucleotide in a single DNA strand 7. bases face outside of the double helix 8. consecutive nucleotides of a single DNA strand are linked by hydrogen bonds 9. here are A-T and G-C pairs in DNA double helix 10. sugar-phosphate backbone of a single DNA strand is formed by linking deoxyribose units and phosphate groups through phosphodiester bonds 11. the two strands of one helix are antiparallel 12.double helix 13. the larger major groove alternates with the smaller minor groove along the length of the double stranded DNA I tried 2,3,4,9,10,11,12,13 together and got it…
- 1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocitySuppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragment
- It has been estimated that each phosphate group in B-DNA can form hydrogen bonds with six water molecules. Draw a diagram of a phosphodiester linkage with its associated water moleculesWhich of the following statements about RNA is/are incorrect? I. RNA strand synthesis does not occur during replication. II. All RNA strands produced during transcription are translated into proteins. III. RNA strands are composed of 10 nucleotide bases per turn. IV. RNA strands can pair with a DNA strand. V. RNA may be synthesized in the 5'-3' orientation and vice-versa (3'-5') depending on the orientation of the template DNA strand O I, II, and IV O I, II, III, IV, and V O II, IV and V O II, IV and V OI, II, III and V O Il and IIIIn one, simple sentence define the function of the following 1. Helicase = 2. Alpha subunit of DNA polymerase III =
- Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?