Q: 1. Imagine you are a farmer researching the impact of Genetically Modified Foods. What is one…
A: Genetically modified organisms (GMOs) are plants whose genetic material has been altered. Utilizing…
Q: In January 2010, a population of organisms had a size of 564. By the end of the year 109 of those…
A: In january 2010 , population of organisms had a size of 564 By the end of the year 109 had died so…
Q: 2) Insert increase or decrease into each of the sentences below which are concerned with blood…
A: Reduced blood pressure causes the baroreceptors to provide less of a signal, which disinhibits…
Q: (a). Four of these energy-rich molecules are produced in glycolysis: (b). Glucose is split into two…
A: Introduction In order to get chemical energy for cellular processes, organisms require oxygen to…
Q: Why do many tumors metastasize (e.g. what advantage does it give them) and why can metastatic…
A: Metastasis is a complex process that is not fully understood. However, it is clear that the ability…
Q: Suppose a new mutation arises in a mitochondrial genome. Explain what would have to happen in order…
A: Mitochondria is a double membrain bound cell organelle found in eukaryotic cells. It contain double…
Q: The following DNA sequence is found on a chromosome in rice plants: 5’…
A: Given DNA sequence: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…
Q: Huntington's disease is characterized by a late onset of nerve degeneration that leads to death.…
A: Huntington's disease is caused by the dominant allele as given in the question.
Q: In the following food chain, what biomass of phytoplankton will have been required to produce a 1 kg…
A: To satisfy their basic necessities, living creatures rely on one another and their surroundings, or…
Q: Which of the following statements are correct about tumors and metastasis (select all that apply)?…
A: Tumor is an abnormal mass of cells which grow and divide more than their requirement or they do not…
Q: The first hominin thought to migrate out of Africa was____. a. P. boisei b. Homo habilus c. Homo…
A: Our ancestros started to move northwars and spread all over the world after leaving their homeland,…
Q: The term archaic Homo refers to a. Homo erectus / H. ergaster b. archaic Homo sapiens c. Homo…
A: INTRODUCTION Archaic human : human species seen between Homo erectus and Homo sapiens.
Q: Among the structurally simplest riboswitches are the two so-called purine riboswitches, one of which…
A: DNA replication occurs prior to cell division and gets the cell ready for mitosis and meiosis.…
Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…
A: Introduction : Peripheral proteins are discovered resting on the surface, whereas integral membrane…
Q: Question 4 For recessive X sex linked traits, females can be O afflicted with the disorder. a…
A: Generally, males are affected with recessive X sex linked disorder as males have only one X…
Q: Organisms ATP NADH NADPH FADH2 Ethanol 1 20 100 0 0 50 2 350 400 0 100 1 3 500 410 200 100 1 Three…
A: Energy is spontaneously produced during cellular respiration, which involves several metabolic…
Q: 18. In tomatoes, tall (D) is dominant over dwarf (d), and smooth fruit (P) is dominant over…
A: A dihybrid cross is a cross in which two traits are involved . Traits are characteristic features…
Q: Which of the following is an example of gene replacement? O Sheep that express the human insulin…
A: "Biotechnology" is the use of our knowledge of biological processes to the development of beneficial…
Q: C. In a horse population, three different traits showing continuous distribution were measured, and…
A: A measure called heritability is used in breeding and genetics to determine how much phenotypic…
Q: Ectodermal Derivatives of the 10 mm Pig Embryo QUESTIONS: State the neuromere origin of each brain…
A: During embryonic development, the cells are arranged in 3 layers-ectoderm, endoderm, and mesoderm in…
Q: Three morphological trends seen in the origin and evolution of modern humans include____. a.…
A: The correct answer is- b. decreases in relative brain size and body size, and a decrease in skeletal…
Q: Define hormone. Name the hormone secreted by thyroid gland. Write its function. Why is it advised to…
A: Hormone: A class of signalling molecules known as hormones—or "setting in motion"—are found in…
Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…
A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…
Q: Which land plant innovations served to protect land plant offspring? Please select all correct…
A: there are several factory which help to survive a plant offspring but some certain factor applicable…
Q: C. Use of Antimicrobials - Disk Diffusion Method + Antibiotic used Ex. Amoxicillin E15 -…
A: An Antibiotic is a chemical substance used to inhibit bacterial growth or it is used to kill…
Q: A KDEL sequence is necessary for ... Select an answer and submit. For keyboard navigation, use the…
A: According to certain theories, the KDEL receptor controls COPI transport. The development of COPI…
Q: Body shape varies systematically: according to altitude along latitudinal clines…
A: Introduction Evolutionary trends in shape type offer a vital context for deciphering variation among…
Q: Which female could be the mother of the child and why? Which male could be the father of the child…
A: There are several ways to identify the mother of a child from VNTR loci. One way is to look at the…
Q: Which of the following statements are correct about the ability of cancer cells to form a secondary…
A: Metastasis is the property of tumor cells to develop a secondary tumor at a site away from that of…
Q: Question: Which macronutrient does fermentation consume to make the fermented food a)Protein…
A: Introduction Fermentation is the process which occurs in the absence of oxygen. It is a biochemical…
Q: Briefly explain How does post-transcriptional regulation work in prokaryotic and euk
A: Post-transcriptional regulation is essential for controlling gene expression in highly dynamic…
Q: In wild sunflowers, populations occurs that are either yellow or white. one variety of true breeding…
A: It is given that, in wild sunflowers, populations occur that are either yellow or white. one variety…
Q: Social inequality, violence, warfare, disease, overpopulation, environmental degradation, lower…
A: Until the advent of agriculture about 10,000 years ago, humans were hunter gatherers. Food supplies…
Q: Give the role of starch solution, phosphate buffer, and NaCI solution in the amylase test. What are…
A: The amylase test is a laboratory test used to measure the level of amylase in the blood. Amylase is…
Q: Which of the following are charcteristics you would expect of a circulating tumor cell that has…
A: An epithelial cell that has undergone transition into a mesenchymal cell, helps in both…
Q: Mature human insulin is synthesized from a single Gene but contains two polypeptide chains (A and B)…
A: In the control of human metabolism, insulin is crucial. The -cells in the Islets of Langerhans…
Q: Please answer this question by drawing on the diagram with different colors and answer all the parts…
A: Meiosis is the cell division process that involves production of 4 haploid (n) daughter cells from a…
Q: Which of the following is NOT involved in oxygen production in photosynthesis? Photosystem I O Light…
A: Introduction : Autotrophic plants produce their own food through a process called photosynthesis.…
Q: If you get the chicken pox and are subsequently immune to the chicken pox, what type of immunity is…
A: Immunity is the ability of body to resist an infection or prevents a pathogen which can infects the…
Q: You ran the agarose gel but forgot to include the lactose-induced 23S reaction (template - cDNA).…
A: If there were white colonies in the plate, then the recombinant clone was created if blue then it…
Q: 8. An insect from a strain breeding true for white eyes (RRww) was crossed to an insect from a…
A: Note - We are supposed to answer one question According to our guidelines. Please repost other…
Q: In wild sunflowers, populations occur that are either yellow flowers (wild type) or white flowers.…
A: A trait is a characteristic feature that is unique to specific individual. Each trait is represented…
Q: DNA is pretty important because it is instructs what proteins to make. the energy producer in a…
A: Introduction DNA is a molecule that was discovered in the late 1860s by Friedrich Meischer in…
Q: Which of the following is the concentration of hemoglobin-bound oxygen in the blood when the heme is…
A: Hemoglobin is a protein in the blood that carries oxygen. It is important because it helps to…
Q: Is the DNA strand in the picture in the template or the non-template strand.
A: Deoxyribonucleic acid also called as DNA which is a polymer composed of two polynucleotide chains to…
Q: An insulin-dependent diabetic patient calls the office complaining of sudden onset of nausea. Upon…
A: Diabetes type 1 is a chronic illness also referred to as juvenile diabetes or insulin-dependent…
Q: Which of the following are thin structures that extend from the surface of the cell and act in…
A: The kingdom Protista includes all eukaryotes that are not animals, fungi, or land plants. Protists…
Q: All of the following apply to tRNAs EXCEPT: (more than one may apply) A. attach amino acids at the…
A: tRNA is a type of RNA molecule that helps to decode a gene's information in order to produce a…
Q: ABM aidT 1. In rabbits, coloration of the fur depends on alleles of the gene c. From information…
A: Introduction : Four fur coat alleles in Rabbits are : C, cch, ch and c. Their dominance order is as…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. Which best describes the mode of inheritance of the afflicting allele in the following pedigree? A. autosomal dominant B. autosomal recessive C. X-linked dominant D. X-linked recessive 2. Suppose that an allele, b, of a X-linked gene is recessive and lethal (if a wild-type allele is not present). A man marries a woman who is heterozygous for this gene. If this couple had a large number of normal children, what would be the predicted sex ratio of these children (ratio of male children to female children)?Shaded in black-white trait (Glucose-6-phosphate dehydrogenase deficiency) 1. What type of x-linked inheritance is shown in the chart above? a. X-linked Dominant b. X-linked Recessive c. Autosomal Dominance d. Autosomal Recessive 2. What is the genotype of individual 1 at generation I? a. XGXG b. XGXg c. XX d. XOA. Identify the inheritance pattern in the pedigree below (dominant, recessive or sex-linked). B. What are the genotypes for individuals Il- 1 and Ill-2? Use alleles A and/or a for your answer. 4 II 10 IV
- 2. Assuming complete penetrance, which type of inheritance pattern is consistent with the pedigree shown here? I-1 I-2 П-1 П-2 П-3 П-4 П-5 III -1 Ш-2 Ш-3 Ш-4 Ш-5 II-6 a. Autosomal recessive c. X-linked recessive b. Autosomal dominant d. X-linked dominantGeneration a. What is the genotype of the mother? b. What is the genotype of the father? c. What are the genotypes of the five children" 41. What is/are the possible inheritance pattern(s) for the characteristic in the following pedigree? 11 a. Autosomal recessive only i b. Autosomal dominant only) c. X-linked recessive only d. X-linked dominant only e. All of the above are possible. 42. What is/are the possible inheritance pattern(s) for the characteristic in the following pedigree? 11 a Autosomal recessive only b. Autosomal dominant only c. X-linked recessive only d X-linked dominant only e. All of them are possible. 43. If the phenotype followed in the pedigree below is X-linked recessive, then the genotype of 11-2 is HI a homozygous dominant b heterozygous chomozygous recessive d hemuzygous dominant e bemizygous recessive1. Red-green colorblindness is caused by a recessive allele (x) at an X-linked gene, and albinism is caused by a recessive allele (a) at an autosomal gene. A phenotypically normal woman (Sara) has a father who is colorblind, and she knows that she is a carrier for albinism. She plans to have a child with a colorblind man (Abdul) who is also a carrier for albinism. What is the probability that Sara and Abdul's child will have one of the conditions, but not both? (C. Follow the steps below to answer this question. a) What is the cross? b) What are the target genotypes? Note: it might be useful to come back to this one and double- check it after you have completed step c, below. Break this down to the single gene level by answering the following questions: a. What is the proportion of normal to albino offspring? Show the Punnett square: b. What is the proportion of normal to colorblind offspring? Show the Punnett square: d) What is the probability that Sara and Abdul's child will have one…
- While studying of the family tree with history of hypertrichosis (hyper hirsutism of the ear) this sign was founded only in the men and it was inherited from father to the son. Define the type of hypertrichosis inheritance? Select one: a. Y-linked b. Autosomal-recessive O c. Autosomal-dominant d. Recessive, X-linked e. Dominant, X-linked2. Identify the type of trait(s) in the pedigree below * autosomal recessive autosomal dominant X-linked dominant X-linked recessive V.linked1. Hemophilia is a disease inherited as a X-linked recessive trait while pattern baldness is controlled by an autosomal gene that is dominant in males and recessive in females. A hemophilic man who is also homozygous for baldness has children with a woman who is not hemophilic but a carrier and heterozygous normal-haired. Show the parental genotypes, the Genotypic ratio (GR) of the offspring and their phenotypic ratio. Separate the total number of the male offspring from female offspring. For example, if there are 8 total number of offspring, count how many are females and how many are males. So if there are 4 females, then the denominator for the genotypic ratio and phenotypic ratio for female offspring is 4. You can convert it to percentage if you want. Answer the following: a. Among the female offspring, what is the probability of having hemophilic but normal haired child? b. Among the male offspring, what is the chance of having a child with normal blood clotting but bald?
- Match the mode of inheritance with its description. (1) autosomal recessive A. inherited by males from carrier mothers(2) autosomal dominant B. inherited from one affected parent(3) X-linked recessive C. inherited from two carrier (unaffected) parents1 II 1 4 6. II 1 2 4 5 6. 8. IV The above image shows a pedigree for a monogenic inherited disease. Although this trait is only observed in males in this family, the pattern of inheritance of this disease is autosomal recessive. Use the pedigree to explain why the inheritance of this disease cannot be autosomal dominant. If this trait is X-linked recessive, what would be the genotypes of the people in Row I? 2. 2. 3. 2. 3.8. Huntington’s disease is a degenerative disease of the nervous system that strikes in middle age. The allele that causes the disease (H) is dominant to the allele that results in the normal condition (h). Answer the following questions about the inheritance of this disease. A. What is the genotype of a man who is normal but whose father had Huntington’s disease? B. What is the genotype of a woman who has Huntington’s disease if both of her parents had Huntington’s disease? C. If a man who is heterozygous for Huntington’s disease marries a woman who is normal, what would you expect for the genotypes and phenotypes of their children? D. If a normal man marries a woman who is homozygous for Huntington’s disease, what do you expect for the genotypes and phenotypes of their children?