Answered: What is the Central Dogma of biology?…

Name: What is the Central Dogma of biology?•. Name FOUR polymers in your bod
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What is the Central Dogma of biology?•. Name FOUR polymers in your body rightnOW.‡. DRAW the new DNA codon for your NEWamino acid (5'-3")gDRAW the new mRNA codon for yournew amino acid (5'-3°).

Science

Biology

What is the Central Dogma of biology? •. Name FOUR polymers in your body right nOW.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 4RQ: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains...

See similar textbooks

Similar questions

DNA Transcription (RNA Synthesis) DNA A Transcription MRNA | Codone 4. Look at the picture above. What do you notice about RNA's nucleotides (base pairs) compared to DNA nucleotides? 5. Finish transcribing DNA to mRNA *Remember (U) Uracil replaces (T) Thymine in RNA molecule* DNA GAT TTA AAC CGT TCA GGT AAG CAA MRNA CỦA AAU
3. Analyzing the Molecules of Life - Molecular Diagnostics An mRNA that encodes a variant of a human protein is as follows (the mutation is highlighted in red): CUUGUUAACAACUAAACGAACAAUCUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAG UCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCAC ACGUGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGA CUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGUAA RT-qPCR can be used to detect the variant (mutation). (a) In a few sentences or using a simple diagram/flowchart, describe the basic principle of RT-qPCR, and show the sequence of a DNA primer that can be used to reverse transcribe the entire RNA molecule as shown at 37 °C. (b) Design a pair of primers (DNA oligonucleotides) for detecting the mutation by qPCR. Assume that the PCR reaction will be performed at 72 °C. Show the sequences of your primers and their estimated Tm.
10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy
A particular DNA coding segment is ACGTTAGCCCCAGCT • Write the sequence of nucleotides in the corresponding mRNA. • Determine the amino acid sequence formed from the mRNA during translation. • What amino acid sequence results from each of the following mutations? a. replacement of the underlined guanine by adenine b. insertion of thymine immediately after the underlined guanine c. deletion of the underlined guanine
Exercise In this exercise we will practice transcribing and translating sample DNA. Using your sample DNA, unzipped and second strand removed, you will first create an RNA strand (transcription). DNA is read in the 5' → 3' direction, so when you create RNA, a 3'end pairs with the 5' end of DNA. From your RNA strand, you will need to create codons; remember that a codon is a group of 3 bases that codes for a specific amino acid. Your codons are read in the 5' → 3' direction (hint: it might be right to left!). You will then need to convert your codons into amino acids in the 5' → 3' direction (translation). DNA strand 3' TAC-TTA-CGA-TGG-TAC-ACG-CAA-TCT-ATA-CTC-AAA-TAT-AGG-ACC-TTG-ACG-TCG-AAT-CTC-CAC-TGT-ACC-TTG-AAC-CTG-ACT 5' RNA strand 5'-AUG-AAU Amino acid sequence G ne (9)
try w1 II. In each of the following DNA sequences, write on your answer sheet the corresponding mRNAtranscript and use the genetic code to determine the resulting amino acid sequence. Note that the givenstrands are in the 3’ to 5’ direction. Start the amino acid sequence with the start codon and end withstop codon.1. TTTTACCATCCCACAATTTA mRNA: _________________________ Amino acids: _____________________ 2. ACTACTTTCAGAGCTATATTCAG mRNA: _________________________ Amino acids: _____________________
Remember when looking up a codon make sure it is in its mRNA form. Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create? 3.What are three differences between a point mutation and deletion mutation
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A frameshift mutation
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A missense mutation that is also a transversion