A particular DNA coding segment is ACGTTAGCCCCAGCT • Write the sequence of nucleotides in the corresponding mRNA. • Determine the amino acid sequence formed from the mRNA during translation. • What amino acid sequence results from each of the following mutations? a. replacement of the underlined guanine by adenine b. insertion of thymine immediately after the underlined guanine c. deletion of the underlined guanine

A particular DNA coding segment is ACGTTAGCCCCAGCT • Write the sequence of nucleotides in the corresponding mRNA. • Determine the amino acid sequence formed from the mRNA during translation. • What amino acid sequence results from each of the following mutations? a. replacement of the underlined guanine by adenine b. insertion of thymine immediately after the underlined guanine c. deletion of the underlined guanine

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
Mutation #2: • Change the Mutation to RED TACACC TIG GC GACGACT A U GU G G A A C C G C UG CUGA MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: MRNA Sequence: Amino Acid Sequence: Mutated TAC GÁC CTT GGC GAC GÁC T DNA mRNA Amino Acid Will this mutation have an effect? What kind of mutation is this? Mutation #3: • Change the Mutation to RED TACACCTT G G C G A C GACT AUGUG G A A C C G C U G C U G A MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: mRNA Sequence: Amino Acid Sequence: Mutated TAC ACC TTA GCG ACG ACT DNA MRNA Amino Acid Will this mutation have an effect? What kind of mutation is
5. A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the corresponding MRNA. • Determine the amino acid sequence formed from the MRNA during translation. What amino acid sequence results from each of the following mutations? replacement of the underlined guanine by adenine insertion of thymine immediately after the underlined guanine deletion of the underlined guanine a. b. C.
Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of each
Quick activity Use the genetic code to translate the following 30 nt mRNA sequence: AUGAUCCUAGGGUGCAUGAUGCCAAAAUAA Prezi 1st letter UUU Phe UCU U UUC JUA UUG U CUA CUG Leu AUU A AUC lle AUA CUU CCU C CUC Leu CCC Pro CCA CCG UAU UCC Ser UAC UCA UAA UCG UAG ACU ACC Second Letter ACA AUG Met ACG C GUU GCU G GUC Val GCC GUA GCA GUG GCG AAU Thr AAC AAA AAG Ala CAU His CAC CAA Gin CAG GAU GAC A GAA GAG Tyr UGU Cys U UGC Stop UGA Stop Stop UGG Trp CGU CGC Arg CGA CGG Asn Lys Glu G AGA AGG Asp GGU Arg DCAG DCA AGU Ser U letter AGC GGC Gly GGA GGG A U VAG U JOJO 3rd G Alb
Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA: 5'-ACGTCAATGGA-3' DNA: 5'-GCGCGGATTAGCGAT-3' mRNA: 3'- mRNA: 3'- mRNA: 3'- mRNA: 3'- -5' -5' -5' -5'
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A frameshift mutation
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A missense mutation that is also a transversion
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A nonsense mutation
• separates the two DNA double helix • matches each DNA nucleotide with a complementary RNA nucleotide • joins each RNA nucleotide to the previous nucleotide in the growing mRNA molecule. 11. Why is RNA polymerase a good name for this enzyme? Explain each part of the name: RNA, polymer and ase. To see the process of transcription in action, https://www.bióinteractive.org/classroom-re- 12. Summarize how transcription makes mRN gene, mRNA, sequence, nucleotides, con Transcription atr
In the DNA segment 5′-ATGAGGCATGAGACG-3′(coding strand) 3′-TACTCCGTACTCTGC-5′ (template strand) • What products would be formed from the segment’s replication? • Write the mRNA sequence that would be obtained from the segment’s transcription. • What is the amino acid sequence of the peptide produced from the mRNA?
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA: