What is AG for the decomposition of CaCO3 at 298 K and a partial pressure of CO2 of 4.00x10-4 bar? CaCO3(s) → CaO(s) + CO2(g) AGrxn (298 K, Pco2 = 0.400 mbar) = ??? CACO3(s) CO2(g) Compound AG°; (kJ mol-') CaO(s) -604 -1129 -394

What is AG for the decomposition of CaCO3 at 298 K and a partial pressure of CO2 of 4.00x10-4 bar? CaCO3(s) → CaO(s) + CO2(g) AGrxn (298 K, Pco2 = 0.400 mbar) = ??? CACO3(s) CO2(g) Compound AG°; (kJ mol-') CaO(s) -604 -1129 -394

Chemistry: Principles and Reactions

8th Edition

ISBN:9781305079373

Author:William L. Masterton, Cecile N. Hurley

Publisher:William L. Masterton, Cecile N. Hurley

Chapter16: Spontaneity Of Reaction

Section: Chapter Questions

Problem 62QAP: Consider the reaction NH4+(aq) H+(aq)+NH3(aq) Use G f for NH3(aq) at 25C=26.7 kJ/mol and the...

See similar textbooks

Related questions

Q: What is the difference between an orbit (such as in the Bohr model) and electron orbital?

A: Orbit is the Path for elcetrons to revolve around the nucleus. While electron orbital is the 3-D mot...

Q: Thiosulfate ion (S2O32-) and dithionite anion (S2O42-) are teo sulfur containing reducing agents. Wh...

A: Given, Thiosulfate ion (S2O32-) and dithionite anion (S2O42-) are thio sulfur containing reducing ag...

Q: ions

Q: How many grams of Xe are there in a sample of Xe that contains 8.97×1023 atoms?

A: First we have to determine the moles of xenon.

Q: Under certain conditions the rate of this reaction is zero order in dinitrogen monoxide with a rate ...

Q: Activity 2: Complete the table below. Lewis Bond Molecular Polarity of Molecule Structure EN Polarit...

Q: A soft drink costs 75 cents for a 12-oz can. A two-liter bottle costs $1.25. How much more expensive...

Q: Some measurements of the initial rate of a certain reaction are given in the table below. [N:] H2|in...

Q: 5. Organic molecules are still subjected to general principles of inorganic chemistry. a. True b. Fa...

A: Generally organic molecules contain C,H,O,N atoms.

Q: d) 1. Н,о*, но HOʻ H 2. КMnOд, NaОН НО 3. Н,О*, д e) H. НО OH

A: Aldehydes and ketones can be selectively protected by 1,2 diols and the again deproctected using aci...

Q: A student is about to dissolve 1.1 g of compound Z in solvent Y. Is 100 mL of solvent Y already enou...

A: Solubility of Z = 3.44 g/L So, 1 L Y : 3.44 g Z

Q: Give the conjugate base of H2O.

A: Acid is substance which release hydrogen ions and base is substance which release hydroxyl ions when...

Q: Use the graph below as reference: What is the composition of the distillate of 55% cyclohexane dist...

Q: 6. Complex Polymer Growth a. Propose a synthesis of the following compound using a commercial carbox...

Q: True or False 1. A strong signal in infrared spectroscopy indicates that a molecule matches the emit...

A: Infrared spectroscopy is a technique to analyze the type of bonds present in the molecule. When the ...

Q: Spell out the full name of the compound.

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show...

Q: Draw the structure of the following compounds. Use line-angle structural formula. 5-chloro-1-ethylsp...

A: Given, The name of the molecules : 5-chloro-1-ethylspiro[2.5]octane * 1-bromo-4-ethyl-5-methyl...

Q: Complete the table below for calculating the molar mass of the ionic compound chromium(III) sulfide ...

A: A compound is formed by the electrostatic interaction between the cation and the anion. The cation i...

Q: Consider the following table: Name Formula Conjugate Acid 1.8 x 10 5 4.38 х 10 4 NH3 NH,+ Ammonia Me...

A: For best buffer solution pH of the solution should be equal to pKa of acid. For effective buffer so...

Q: What is the final glycosidic link to be broken during glycogen debranching? a-1,3-glycosidic linkage...

Q: The scientific methods is applied to natural phenomena. What is natural phenomena? Give two examples...

Q: Some measurements of the initial rate of a certain reaction are given in the table below. N2|H2| ini...

Q: ry1 aser - A un kown aas with the percent Composition unkown gas 4.18 Hand 71.7 CI Occupic 244.3.1C ...

A: Since, you have posted a question with multiple sub-parts, as per our company guidelines we are supp...

Q: A compound is found to contain 31.42 % sulfur, 31.35 % oxygen, and 37.23 % fluorine by mass. What is...

Q: Highlight the atoms that would be directly attached to a hydrogen in the acidic form of this molecul...

A: Higher electronegative elements (Nitrogen,oxygen,fluorine) can form hydrogen bonding. Following atom...

Q: Which of the following reactions will lead to a major product that exists as a 1:1 mixture of two di...

Q: Hl ОН The structure shows which configuration? AR B) s

Q: O Aromatic

Q: 1. Which match is correct for thermal [2+2] cycloaddition reaction (a) suprafacial /suprafacial →All...

A: [2+2] cycloaddition

Q: Directions: Complete the table below about the Kinetic Molecular Theory of Liquid and Solid. Descrip...

A: Please find your solution below : According to Kinetic Molecular Theory, the matter consist of parti...

Q: Unknown elemental metal was reacted with Hydrochloric Acid. It was determined that this reaction evo...

A: Given:- Mass of Metal used = 0.3682 g P (atmospheric) = 761.1 mm Hg Temperature of gas = 21.6 de...

Q: B) Enantionmers

Q: At a certain temperature this reaction follows second-order kinetics with a rate constant of 0.0152M...

Q: 1. How many MOLECULES of sulfur trioxide are present in 4.25 moles of this compound ? molecules. 2. ...

A: Mole concept: The number of molecules or atoms present in the one mole of the substance is equal to ...

Q: Q.No. 5 Absolute stereochemistry of the given compound is: 8a 4a OH (A) 4aR. 8aS () 4aR. 8aR (c) 4aS...

A: Since you have asked multiple questions, we will solve the first question for you. If you want any s...

Q: This is the excessive bending of bonds exhibited by a carbons at the point of rotation which creates...

A: Strain arises due to the repulsion between the bond electron of the molecule . So the molecule are a...

Q: 2. Lone pair occupies a hybridized p-orbital allowing it to delocalization to a nearby side-way over...

Q: How many molecules of water occur per formula unit of MgSO4. Write the complete formula of the hydra...

Q: Suppose a 3.00 L scuba tank is filled with about 29.7 moles of air at the ocean surface. If the tank...

Q: Draw the structures of the ff molecules: A. 1,4-Diformylhex-5-en-3-one B. 3-(1,2-Dimethylpropyl)-4-m...

Q: Of the initial radte ol a tion are yiven in the labie belo N2 H2 initial rate of reaction 0.776M 2.2...

Q: the ED50 of a recreational drug be defined as the amount required for 50% of a test group to feel hi...

A: ED50 of a recreational drug be defined as the amount required for 50% of a test group to feel high o...

Q: . Based from the molecular structure below, which shows the weakest Dispersion Forces? II H HH H C. ...

A: Note : As the size of the molecule (molar mass) increase or the longer the carbon ttje magnitude of...

Q: СООН HN= A НО H2N- -ОН H3COC H2NOCH2C E CH2CH2OCH3 CONH2 CIOCH2C CH2COCH3

Q: 4.Write the products of the reactions below showing stereochemistry and regiochemistry (you may writ...

Q: Calculate the pH of a solution formed by mixing 120.0 mL of 0.30 M HClO with 1180.0 mL of 0.20 M LiC...

Q: Which of the following HC is most soluble in water? A) Benzene and derivatives B Alkyne C) Alkane D)...

A: The correct option is option A.

Q: Which Newman projection is generally more stable? A Staggered B Eclipsed

A: Stereochemistry is branch of chemistry which deals with the spatial arrangement of atoms in molecule...

Q: em101 A app.101edu.co Word 2 Resource Library - Dashboard wco Writing Centers at. O 11-0218 NCI Theo...

A: Given Reaction:- H3C6H5O7 + 3NaOH -----> Na3C6H5O7 + 3H2O Volume of solution = 25.0mL or 0.0250 ...

Concept explainers

Solutions

Solutions can be considered as homogeneous mixtures which contain two or more than two chemical substances. The chemical substance which is the greater part is defined as solvent. And the chemical substance that is dissolved in a solvent is referred to as solute. Solution chemistry plays an important role in chemistry since it supports many commercial applications of solutions.

Question

What is AG for the decomposition of CaCO3 at 298 K and a partial pressure of
CO2 of 4.00x10-4 bar?
CaCO3(s) → CaO(s) + CO2(g)
AGrxn (298 K, Pco2 = 0.400 mbar) = ???
CO2(g)
Compound
AG°; (kJ mol·1)
CACO3(s)
СаО(s)
-1129
-604
-394

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.

Similar questions

Which of the following quantities can be taken to be independent of temperature? independent of pressure? (a) H for a reaction (b) S for a reaction (c) G for a reaction (d) S for a substance
Calculate the standard Gibbs free-energy change when SO3 forms from SO2 and O2 at 298 K. Why is sulfur trioxide an important substance to study? (Hint: What happens when it combines with water?)
Consider a metal ion A2+ and its nitrate salt, In an experiment, 35.00 mL of a 0.217 M solution of A(NO3)2 is made to react with 25.00 mL of 0.195 M NaOH. A precipitate, A(OH)2, forms. Along with the precipitation, the temperature increases from 24.8C to 28.2C. What is H for the precipitation of A(OH)2? The following assumptions can be made. â€¢ The density of the solution is 1.00 g/mL. â€¢ Volumes are additive. â€¢ The specific heat of the solution is 4.18 J/g C.
Calculate H when a 38-g sample of glucose, C6H12O6(s), burns in excess O2(g) to form CO2(g) and H2O() in a reaction at constant pressure and 298.15 K.
Suppose you have an endothermic reaction with H = + 15 kJ and a S of 150 J/K. Calculate G and Keq at 10, 100, and 1000 K.
ou place hot metal into a beaker of cold water. ol type='a'> Eventually what is true about the temperature of the metal compared to that of the water? Explain why this is true. i>Label this process as endothermic or exothermic if we consider the system to be the metal. Explain. the water. Explain.
C6H12O6(aq) + 6O2(g) 6CO2(g) + 6H2O(l)ΔH = –2802.7 kJ mol –1a) Write an expression for the equilibrium constant for this reaction.b) At equilibrium, the concentration of the reactants and products are determined as [CO2] = 0.30 M, [O2] = 0.040 M and [C6H12O6] = 0.065 M. Determine the value of the equilibrium constant (Kc) and predict the whether the products or reactants will be favoured at equilibrium.c) Given that the concentrations of the reactants and products at a particular time are [CO2] = 0.65 M, [O2] = 0.020 M and [C6H12O6] = 0.055 M, determine the reaction quotient (Qc). Compare the Kc and Qc values and predict the favoured direction of the reaction.d) Explain the effect on equilibrium of:i) Increasing temperatureii) Increasing pressureiii) Decreasing the concentration of oxygeniv) Increasing the concentration of carbon dioxidev) Adding a catalyst
H3C. (k) Zn/CH;COOH > 1Q + 1R heat H3C
Calculate the reaction quotient, Qr for the following reactions and conditions: 7. 2 SO3(g) → 2 SO2(g) + O2(g) 16.5; Pso3 = 0.45 atm; Pso2 = 1.52 atm; : Кр %3 Po2 = 0.210 atm
U E Phosphoryl chloride, POCI3(g), is used in the manufacturing of flame retardants. It is manufactured in an equilibrium process in which phosphorus trichloride reacts with nitrogen dioxide to form POCI3(g)and NO(g) according to the following equation: PC|3 (g) + NO₂ (g)POCI3 (g) + NO (g) The Keq for this reaction at 800 Kc is 3.88. If 1.35 mol PCl3 (g) and 1.74 mol NO₂ (g) are placed into a 2.5 L container, how many moles will there be of each gas when the reaction reaches equilibrium POCI 3 (g) + PC|3 (g) + NO₂ (g) = NO(g) Kc = 3.88
6. When the ideal-gas reaction A+B=C+Dhas reached equilibrium, state whether or not each of the following relations must be true. Here n¡ is the number of moles of species i in equilibrium, P, is the partial pressure of i, and µ; is the chemical potential of i. Here a simple True or False answer is sufficient. (a) nc+np=nA +ng (b) Pc+Pp=PA+PB (c) na=ng (d) nc=na (e) If only A and B are present initially, then nc=np (f) Ha + HB= Hc+ Hp no matter what the initial composition. (g) If only A and B are present initially, then in equilibrium we must have nc # 0. (h) The equilibrium constant Kp(T)= PĄPB/(PcPp). (i) The value of –RT In Kp(T) = µE(T)+µ8(T)– H3(T) –- H§(T). ) The equilibrium constant is independent of the total pressure.
At 25 °C, the equilibrium partial pressures for the reaction 3 A(g) + 2 B(g) = C(g) + 2 D(g) were found to be PA = 4.24 atm, PB = 5.83 atm, Pc = 4.52 atm, and Pp = 4.85 atm. %3| What is the standard change in Gibbs free energy of this reaction at 25 °C? kJ AGXN = mol