Q: What happens to the pre-mRNA before it migrates to the cytoplasm? Explain
A: Answer: TRANSCRIPTION : It is the process in central dogma where DNA is transcribed in to RNA by…
Q: Which enzyme removes a phosphate from the 5' end of the MRNA, leaving two phosphates?
A: mRNA is a messenger RNA, it is a single stranded RNA which carries the genetic sequence of the DNA…
Q: What is RNA splicing?
A: RNA is a long chain of ribonucleotides connected together via phosphodiester bonds. It works in gene…
Q: Explain why the translation of a given mRNA can be inhibited by a segment of its complementary…
A: A mechanism of reading and decoding the nucleotide sequences of messenger ribonucleic acid (mRNA)…
Q: What is polycistronic mRNA ?
A: Polycistronic mRNA is a characteristic feature of prokaryotes but they are also present in…
Q: Describe how eukaryotic mRNA is processed
A: The central dogma of molecular biology briefs that DNA has instructions to synthesise proteins which…
Q: What are polycistronic mRNAs?
A: Transcription refers to the process of synthesizing the RNA from the template of DNA…
Q: How does a mRNA molecule carry information from DNA?
A: mRNA is a single stranded rna molecule that is complementary to the DNA strands of a gene. mRNA…
Q: what is it called when an mRNA is edited and where does it happen?
A: Commonly it’s known that mRNA is produced during the process of transcription which will then go for…
Q: How Is the Base Sequence of mRNA Translated into Protein?
A: Translation is a process by which the genetic code contained within a messenger RNA (mRNA) molecule…
Q: How is it possible that a given mRNA in a cell is found throughout the cytoplasm but the protein…
A: Introduction The main crucial elements of the genome are the genes which controls all the cellular…
Q: what is c-abl mRNA
A: An mRNA is the RNA encoded from a stretch of DNA template strand to serve as a template for the…
Q: Which of the following is required for RNA splicing to occur?
A: RNA splicing is the process in which newly made precursor m-RNA is transferred into a mature mRNA.
Q: Where in eukaryotic cells does mRNA synthesis occur? To where do these molecules migrate?
A: Eukaryotic cell: This cell contains the nucleus, lysosomes, endoplasmic reticulum, mitochondria,…
Q: Why may tRNA be considered the “interpreter” of the genetic code?
A: Introduction: RNA is a type of nucleic acid that is a genetic material in some viruses. There are…
Q: What is the mRNA for a Coding Strand of TAT?
A:
Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3
A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…
Q: what three things must happen to the pre-mRNA before it is allowed to exit the nucleus?
A: In most of the prokaryotes as well as the eukaryotes, Deoxyribonucleic acid or DNA is the genetic…
Q: How do cells make a mature mRNA from a gene whose coding sequences are interrupted by introns?
A: During the splicing of an RNA molecule, there are two major parts, one is a coding part, known as…
Q: of mRNA that contains a total of 66 codons. What is the maximum number of amino acids that could be…
A: The formation of mRNA from DNA is called transcription and from mRNA to a protein called…
Q: Name and explain the process by which mRNA is formed.
A: Gene expression is the process by which information which is contained in genes is decoded to…
Q: Define the pre-mRNA & mRNA spliceforms of Cassette exons ?
A: Cassette exon splicing is also known as exon skipping and is the most prevalent form of alternative…
Q: What role does the poly(A) tail play in mRNA function?
A: Polyadenylation is a process in which poly (A) tail is added to the 3' end of the newly synthesized…
Q: Define the role of mRNA localization and translational control ?
A: mRNA Localization (is a multi-step process). The pre-mRNA is bound by RNA binding proteins (blue…
Q: What is antisense RNA? How does it affect the translation of a complementary mRNA?
A: The DNA is replicated via a process called DNA replication. After this process, the DNA enters in…
Q: What Are the Mechanics of mRNA Translation?
A: The process of translation involves protein synthesis from messenger RNA (mRNA).Ribosomes translate…
Q: Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that…
A: The process in which amino acid is incorporated into the polypeptide chain with the help of a…
Q: What is the anticodon that would pair up with the MRNA codon UAG? In What part of the cell is…
A: The central dogma of molecular biology includes replication, transcription and translation. Between…
Q: Which of the following RNAS is the product of transcription?
A: Transcription is the process of making an RNA copy of a gene sequence
Q: After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief…
A: In eukaryotes, the process of transcription and translation takes place in separate compartments.…
Q: If the base sequence of a segment of a molecule of DNA is changed, will the base sequence of the…
A: The genes are segments of DNA that contain hereditary information. Some part of this gene is…
Q: What are the major differences in the synthesis and structure of prokaryotic and eukaryotic mRNAs?
A: 1) Prokaryotic: are a single celluler organism that has a diameter of 0.1–5 μm, they have a…
Q: How many amino acids are coded for by the following mRNA: 5…
A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…
Q: What is the cellular structure to which mRNA molecules bind to start the protein synthesis?
A: Protein plays an important role in the structural and functional unit in the body. Proteins are made…
Q: What are the termination of transcription explain briefly?
A: The central dogma of biology explains the flow of information from genes to protein by two…
Q: UGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the name of the sixth amino acid in the protein formed from…
A:
Q: why is it important that unprocessed mrna never leaves the nucleus?
A: Transcription is the process by which genetic information present in a DNA sequence is copied into…
Q: What is alternative splicing of pre-mRNAs?
A: When a single pre- mRNA is spliced in more than one way to produce two or more than two mature…
Q: What is an example of a human disease that results from defective RNA processing? What kind of RNA…
A: Genetic diseases are those diseases that are transmitted from parents to offspring. It occurs due to…
Q: What is the difference between mRNA and miRNA?
A: The ribonucleic acid (RNA) plays a role in the hereditary in bacteria and some viruses. RNA is a…
Q: How do sRNAs alter the translation of target mRNAs?
A: Introduction: Small RNAs or sRNAs produced by bacteria are 50-500 long nucleotide sequences that are…
Q: Define the pre-mRNA & mRNA spliceforms of Intron retention ?
A: Pre-mRNA is defined as the first transcript that occurs from a gene that is protein coding in…
Q: What percent of the transcription in a human cell makes protein-coding RNA, and what percent of…
A: The human genome consists of both the regions, which code for proteins and then which do not. The…
Q: Why mRNA is much more variable in its 3-dimensional shape than is DNA? does there is implications of…
A: Introduction DNA and RNA are the main genetic material found in all the species irrespective of…
Q: How does the pre-MRNA transcript in the nucleus of a eukaryotic cell compare to the MRNA found in…
A: How does the pre-mRNA transcript in the nucleus of a eukaryotic cell compare to the mRNA found in…
Q: If methionine is always the first amino acid incorporated into an oligopeptide, what oligopeptide is…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: Alternative splicing of the same pre-mRNA produces two isoforms.
A: 30) During RNA splicing , the introns are precisely excised and exons are ligated together. However…
Q: Name the process in which unwanted mRNA regions are removed & wanted regions are joined.
A: Transcription is a process in which the DNA template is synthesized into mRNA. At the end of…
Q: What is the first anticodon recruited to an mRNA?
A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…
What amino acid sequence is coded by the following mRNA base sequence?
Step by step
Solved in 2 steps
- A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide?Amino sequence: Gln-Glu-Val-Leu-Ile-Arg-Leu-Phe-Lys-Gly-His-Pro-Glu-Thr-Leu-Glu-Lys-Phe-Asp-Lys-Phe-Lys-His-Leu-Lys-Ser-Glu-Asp-Glu-Met-Lys-Ala-Ser-Glu-Asp-Leu-Lys A) List the fragments generated with trypsin: B) List the fragments generated with chymotrypsin (5 pts) (assume reaction conditions are used to maximize cutting to the C-terminal size of only the 3 aromatic amino acids.)Glycosylation is a major type of protein post-translational modification. Identify the amino acid that is joined to each monosaccharide by a glycosidic bond. glycoprotein A glycoprotein B glycoprotein C HA HO Н CH₂OH HO OH Н H CH₂OH Н ОН HO HN-C-CH3 о c=0 NHI -NH-C - CH2C-H ОН Н нн ОН НН CH2OH Он OH HO Н NH 1 С=0 -CH2-C-н NH C=0 LO-CH2-C-H NH A В с
- Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopTranslate the given amino acid sequence into one-letter code. Glu-Leu-Val-Ile-Ser-Ile-Ser-Leu-Ile-Val-Ile-Asn-Gly-Ile-Asn-Ala-Thr-Leu-Ala-Asn-Thr-Ala Translated code: X IncorrectConsider the following two peptides: I. N-Pro-Pro - Glu - Glu - Tyr - His - Cys - Ala - Glu - Gln - Lys - Leu - Ser - Ser - Phe-Leu- Thr - C II. N-Pro-Pro - Lys - Arg - Gly - Tyr - His - Gly - Glu - Asp - Glu - Asp - Glu - Ser - Gly-Phe- Tyr-C Give three reasons why_peptide I is more likely to form an alpha helix in aqueous solution at pH 7.0. Your reasons may include why_peptide Il is less likely to form an alpha helix
- Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-TyrWrite a possible mRNA base sequence that would lead to the production of this pentapeptide. (There is more than one correct answer.) Gly–Ala–Cys–Val–TyrExamine the peptide. Thr‑Lys‑Pro‑Ile‑Val‑Ala‑Pro‑Met‑Glu‑Tyr‑Gly‑LysThr‑Lys‑Pro‑Ile‑Val‑Ala‑Pro‑Met‑Glu‑Tyr‑Gly‑Lys Write the sequence using one‑letter abbreviations. Estimate the net charge on the peptide at pH 7. Estimate the net charge on the peptide at pH 12.
- Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr - do it on this formatChanging one amino acid within a protein sequence from a tryptophan to a stop codon would be best classified as Amino acids groups Group Characteristics Names Ala, Val, Leu, Ile, Pro, Phe Trp, Met Ala: A Leu: L non-polar hydrophobic Arg: R Asn: N Lys: K Met: M Asp: D Cys: C Gly: G polar hydrophilic (non-charged) Gly , Ser, Thr, Cys, Tyr, Asn Gln Phe: F Pro: P Ser: S acidic negatively charged Asp, Glu Glu: E Gln: Q Thr: T His: H lle: I Trp: W Туr: Y Val: V basic positively charged Lys, Arg, His A) Conservative missense O B) Nonsense O C) Neutral O D) Non-conservative missenseWhich peptide would absorb the most UV light at 280nm? (Can you show work because I mainly want to know how to solve this type of problem. Thank you!)Leu-Trp-Tyr-Ala Tyr-Lys-Tyr-Cys Glu-Tyr-Ile-Arg Ala-Trp-Trp-Ala Thr-Ala-Ile-Thr