Under what conditions does the active functioning of pancreatic lipase occur? What is its mechanism of action
Q: The proton gradient across the inner mitochondrial membrane is produced.... by passing electrons to…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: Which of the following is the base component of the intracellular buffer? H₂CO3 HCO3 O H3PO4 O H₂PO4…
A: Buffers enable biological systems to maintain the pH within a particular range. Intracellular…
Q: Q10.1: Answer the following three-part question. a) Calculate the ΔEº’ for the citrate cycle…
A: Converting malate to oxaloacetate: The regeneration of oxaloacetate in the citric acid cycle is…
Q: In order to study protein structures and functions, many protein techniques have been developed for…
A: There are various techniques in order to study about protein , whether be it's function or…
Q: Which of the following is CORRECT?
A: In the reaction of Glycolysis, the △G values of the three irreversible reactions are : Glucose +…
Q: Why is the name the "citrate cycle" a more accurate name for the metabolic pathway discovered by…
A: Critic acid cycle also called as tricarboxylic acid cycle is the second stage in aerobic cellular…
Q: A patient exhibiting all of the symptoms of beriberi is placed on a thiamine- rich diet, but it does…
A: Carbohydrates consumed in diet enter the glycolytic pathway as glucose. Pyruvate is the end product…
Q: is this protein folding funnel from a metamorphic protein? yes or no? is there one intermediate…
A: Anfinsen hypothesis postulates that under native conditions, the three-dimensional structure of a…
Q: A structure of tyrosine is given and I need to draw the structure for neutral solution, pH 2 and pH…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…
Q: Kinesin movement is dependent on GTP hydrolysis. True False
A: Kinesin is a motor protein that is essential for the cellular functions like mitosis, transport of…
Q: BIOC 385 Biochemistry of Protein Synthesis Q11.4: Considering that binding of the correct tRNA to…
A: Translation is the process of protein synthesis. It occurs in the cytoplasm. Ribosomes have peptidyl…
Q: Virtually all animal cells have a Na+/K+ pump. Which of the following statements concerning it is…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Find 3 reactions that facilitate the synthesis of oxaloacetate
A: The tricarboxylic acid cycle (TCA) is the metabolic pathway that generates NADH and FADH2 for…
Q: could you please write the equation on paper with pen? I cannot understand the equation clearly.
A: The competitive inhibitors are the molecules which inhibits the enzyme catalyzed reaction by binding…
Q: a. What is the name of metabolite 1? b. What is the name of metabolite 2? c. What molecule a is…
A: Purines are heterocyclic organic compound that has 5-member rings fused to a 6-member ring.…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: The glycerol is a 3-carbon structure. (C―C―C) To each carbon atom there is attached one -OH group…
Q: Compare and contrast glycogen synthesis/degradation in muscles as compared with the liver.
A: Glycogen is a storage polysaccharide made up of glucose units linked by alpha 1,4 and alpha 1,6…
Q: Which of the following polypeptides CANNOT be phosphorylated? O a. -LIYLIA- O b. O C. O d. O e.…
A: A polypeptide is a chain of amino acid residues linked together via a peptide bond. Amino acids are…
Q: If the range of the graph in the first part of the question is supposed to be between 5 and 10,…
A: Changes in pH affect the ionisation of active site residues of an enzyme and alters the rate of…
Q: Pyrosequencing uses what reactants?
A: INTRODUCTION : Pyrosequencing : It is a process/technique of DNA sequencing ( which itself is the…
Q: Classification of lipids.
A: A category of heterogeneous chemical substances that are soluble in non-polar solvents are referred…
Q: The word root erythr/o means?
A: INTRODUCTION : Word roots in medical field - In the field of Medical science , a different and…
Q: does BPG bind to deoxyhemoglobin only?why BPG does not bind to oxyhemoglobin? what is chemical…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: Choose an answer in the bracket Why does the yield decrease when the concentration of Fe3+Fe3+ is…
A: Metabolism is set of reaction occurs in living organism to sustain the life. it is consist of…
Q: An in vitro experiment used the isotope 14C-acetyl-CoA to identify 14C- oxaloacetate (OAA) as the…
A: Citric acid cycle - it is also called as Krebs cycle or the TCA cycle (tricarboxylic acid cycle)…
Q: LO 53- Determine the type of mutations based on the effect in the amino acid chain "missense,…
A: Missense, non-sense and silent mutation are the types of point mutation. In point mutation, one base…
Q: Which of the following is TRUE under the following conditions: the enzyme concentration is 2.5 nM,…
A: The rate of reaction can be determined by using Michaelis Menten equation. Michaelis Menten equation…
Q: After several days of fasting, the liver begins producing relatively large amounts of ketone bodies.…
A: Ketone bodies refers to the following compounds: acetone, acetoacetate & β-hydroxybutyrate. They…
Q: Choose the best answer for each blank. The pyruvate dehydrogenase (PDH) complex is regulated by the…
A: Glucose is oxidized during glycolysis and the end product (pyruvate) is converted to Acetyl CoA via…
Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…
A: Hormones are signalling biomolecules that are released from endocrine cells into the bloodstream and…
Q: What does RNAi do? O a. O b. O C. It binds to DNA double helix and cleaves DNA. It inhibits…
A: RNAi or RNA interference is an highly conserved process.
Q: For the net production of a molecule of glucose from CO₂, ribulose-1,5-bisphosphate must react with…
A: Synthesis of glucose from phosphoglycerate occurs through the process gluconeogenesis. ribulose 1,5…
Q: Why is RNA splicing important to cellular processes and protein synthesis?
A: As per the central dogma of molecular biology, DNA contains the information needed to synthesize…
Q: All lipids are absorbed into absorptive cells of the small intestine by which process? Primary…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: 1 enzymes are a class of proteins that catalyze biochemical reaction.what are ribozymes? 2 what is…
A: Enzymes are usually composed of proteins which catalyzes biochemical reactions by decreasing the…
Q: What are the effects of amytal and myxothiazol on NADH and FADH2 oxidation, respectively, given that…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: true or false: The nitrogen atoms in purine rings come from glutamine.
A: Purine and pyrimidine are the two bases involved in formation of nucleotides.
Q: Sample w/ water w/ pancreatin Observation Exploratory questions: 3. What type of hydrolysis is used…
A: Animal fat and vegetable oils are simple fats or triglycerides. Triglycerides are fatty acid esters…
Q: a) It is known that double stranded DNA is denatured at low pH. pKa…
A: When a DNA solution is heated enough, the double-stranded DNA unwinds and the hydrogen bonds that…
Q: Would increasing the concentration of glucose be a physiologically reasonable way to increase the…
A: In order to answer this question, first we need to find the intracellular concentration of glucose…
Q: In addition to the oxidation of cytochrome c by Comple transport systems, what other reaction is…
A: Introduction The electron transport chain (ETC) is the last part of aerobic respiration. An electron…
Q: (a) An experiment can be designed to test the effect of different temperature levels on the…
A: The independent variable is the parameter which we expect to affect the dependent variable. The…
Q: true or false: Aspartate trans-carbamoylase is inhitibited by ATP, an example of feedback…
A: Aspartate transcarbamoylase or ATCase is an allosteric enzyme that catalyses the first step of…
Q: The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5'…
A: DNA is double stranded & during replication both of its strands unwind to produce single…
Q: Explain the importance of solubility in drug product formulation. 2.
A: Solubility, the phenomenon of dissolving a solute in a solvent to produce a homogeneous system, is…
Q: true or false: The conversion of orotidine 5’-monophosphate (OMP) to uridine monophosphate (UMP)…
A: Orotidine 5'-monophosphate (OMP), also known as orotidylic acid, is a pyrimidine nucleotide .
Q: Determine whether each event occurs during initiation, elongation, or termination. Initiation…
A: During translation, mRNA is translated into amino acid sequence. Translation occurs in three steps:…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Use a schematic diagram to briefly summarize the steps taken during the separation, isolation, and…
A: Milk is the secretion of fluid from the mammary gland, the full cream milk is composed of ~54.5%…
Q: Add curved arrows to show the mechanism of nucleophilic attack. Select Draw ||||||||||COH P : 0: | :…
A: A nucleophile is a chemical species that is negatively charged or has a high electron density or a…
Under what conditions does the active functioning of pancreatic lipase occur? What is its mechanism of action?
Step by step
Solved in 2 steps
- What is the mechanism of the effect of urea as an inhibitor and NaCl as an activator in the activity of salivary α-amylase?How are the protein-digesting enzymes in pancreatic juice activated? What is the logic of this arrangement?What is the origin of the triacylglycerols transported by very low-density lipoproteins?
- Given the nature of the hormonal activation of lipases, what carbohydrate pathways would be activated or inhibited under the same conditions?What enzymes are present in pancreatic juice? Explain thefunction of each.Describe the main actions in the mouth, stomach, small intestine, and large intestine during lipid digestion and absorption. Describe the substrate(s) and product(s) of each of the give major enzymes we discussed: lingual lipase, gastric lipase, pancreatic lipase, phospholipase A2, and carboxyl ester lipase. Describe emulsification of lipids. Why does this need to happen for digestion and absorption to occur? Describe how lipids are absorbed at the apical membrane. Describe lipid transport in the enterocyte. Describe lipid transport across the basolateral membrane and into circulation. Define the brain-gut axis and give examples of how lipids impact. Give examples of symptoms related to malabsorption of lipids. Give examples of diseases/conditions involving malabsorption of lipids.
- Is ketogenesis anabolic or catabolic? Thus, what initiates the ketogenesis in our body?What is autophagic intracellular digestion? Why is this type of intracellular digestion intensified in an organism undergoing starvation?Why is it necessary for enzymes that digest protein to be secreted in an inactive form?
- A 10-year old boy recently joined a soccer team and complains of muscle pain and lightheadedness after each of his last three games. Further testing identifies that he has a defect in his lipolysis pathway, specifically a mutation in the lipase that is phosphorylated in response fasting and exercise. (1) Which lipase is defective in this patient? (A) perilipin(B) adipose triglyceride lipase (C) hormone-sensitive lipase (D) monoacylglycerol lipase (E) protein kinase AThe medication Zantac→ that Sam took for the pain relief is an H2 blocker (receptor antagonist). What is the normal function of histamine in the stomach and how might this help Sam’s hyperacidity problem?How does the process of ketone body formation in the liver protect protein from being degraded, and why is thisgood for a person?