TTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene) 2. Provide the FULL protein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein. 6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference. 7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog). 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
GTTTTCACTGGCGAGCGTCATCTTCCTACT
1. Identify the gene from which the query sequence originates (Name of the gene)
2. Provide the FULL protein sequence encoded by the gene.
3. Are different splice variants known for this gene?
4. What human disease has been connected to this gene?
5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the
protein carries no net electrical charge) of the protein.
6. Provide the reference (in proper reference form: Author; Year; Title; Journal
Name; Volume; Page Numbers) for a recent publication involving the identified
gene. This reference should NOT be a web page reference.
7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate
homolog).
8. What is the function (e.g. transcriptional regulation, transmembrane signaling,
kinase, protease, etc.) of the protein(s) encoded by the gene.
9. Generate a FULL protein sequence alignment for one of the identified putative
protein products with at least one similar invertebrate protein (if there is none, use a
vertebrate homolog).
10. Generate a secondary structure prediction for one identified protein.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images