The sequence shown below is an actual sequence of the toxin gene from Salmonella enterica subspecies serovar Typhimurium strain obtained from the NCBI database. ATGCGAACCTTCAAAACCAGGTGGTTTAACAGAGAAGCGAAGCCCCACACGATAAAAGATGACGAGTTAA GCGAGGCCATCAACGCCGTACTGCAAGGAAAAGCAGATAATCTTGGCGGCGGGGTTTATAAAAAACGTCT CAATCAAAATCGCGATCGCGCAATCGTGTTGGCAAAGGGAGGCGAACATTGGTTTTACACCTTCCTGTAT GCCAAACAGGATATGGCCAACATTAGCTATCGCGAACTCGCGGGTTTCCGTGAGTTAGCAAAACACTATG CTTGCCTGACCGAAGATCAGATAACGGCACTCATTAATAACAAAGAACTGGTAGAGGTGCGCCATGTCAG CAAAAACTAA (i) Is the nucleotide sequence above translatable into a complete protein? Give justification. (ii) Is the sequence above represented in the standard FASTA format? Explain your answer. (iii) Liliana, a research officer would like to perform a multiple sequence alignment between the sequence above with eight other toxin genes sequences obtained from other researchers. Define multiple sequence alignment. (iv) Which multiple sequence alignment program would you recommend to Liliana for the comparison of the toxin sequence above with other toxin genes from other organisms?

Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Chapter19: Genomes And Proteomes
Section: Chapter Questions
Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...
icon
Related questions
Question
The sequence shown below is an actual sequence of the toxin gene from Salmonella
enterica subspecies serovar Typhimurium strain obtained from the NCBI database.
ATGCGAACCTTCAAAACCAGGTGGTTTAACAGAGAAGCGAAGCCCCACACGATAAAAGATGACGAGTTAA
GCGAGGCCATCAACGCCGTACTGCAAGGAAAAGCAGATAATCTTGGCGGCGGGGTTTATAAAAAACGTCT
CAATCAAAATCGCGATCGCGCAATCGTGTTGGCAAAGGGAGGCGAACATTGGTTTTACACCTTCCTGTAT
GCCAAACAGGATATGGCCAACATTAGCTATCGCGAACTCGCGGGTTTCCGTGAGTTAGCAAAACACTATG
CTTGCCTGACCGAAGATCAGATAACGGCACTCATTAATAACAAAGAACTGGTAGAGGTGCGCCATGTCAG
CAAAAACTAA
(i)
Is the nucleotide sequence above translatable into a complete protein? Give justification.
(ii) Is the sequence above represented in the standard FASTA format? Explain your answer.
(iii) Liliana, a research officer would like to perform a multiple sequence alignment between
the sequence above with eight other toxin genes sequences obtained from other
researchers. Define multiple sequence alignment.
(iv) Which multiple sequence alignment program would you recommend to Liliana for the
comparison of the toxin sequence above with other toxin genes from other organisms?
Transcribed Image Text:The sequence shown below is an actual sequence of the toxin gene from Salmonella enterica subspecies serovar Typhimurium strain obtained from the NCBI database. ATGCGAACCTTCAAAACCAGGTGGTTTAACAGAGAAGCGAAGCCCCACACGATAAAAGATGACGAGTTAA GCGAGGCCATCAACGCCGTACTGCAAGGAAAAGCAGATAATCTTGGCGGCGGGGTTTATAAAAAACGTCT CAATCAAAATCGCGATCGCGCAATCGTGTTGGCAAAGGGAGGCGAACATTGGTTTTACACCTTCCTGTAT GCCAAACAGGATATGGCCAACATTAGCTATCGCGAACTCGCGGGTTTCCGTGAGTTAGCAAAACACTATG CTTGCCTGACCGAAGATCAGATAACGGCACTCATTAATAACAAAGAACTGGTAGAGGTGCGCCATGTCAG CAAAAACTAA (i) Is the nucleotide sequence above translatable into a complete protein? Give justification. (ii) Is the sequence above represented in the standard FASTA format? Explain your answer. (iii) Liliana, a research officer would like to perform a multiple sequence alignment between the sequence above with eight other toxin genes sequences obtained from other researchers. Define multiple sequence alignment. (iv) Which multiple sequence alignment program would you recommend to Liliana for the comparison of the toxin sequence above with other toxin genes from other organisms?
Expert Solution
steps

Step by step

Solved in 2 steps

Blurred answer
Knowledge Booster
Genomics
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning