The first 15 bases of the original coding informational strand of DNA (which continues after what is shown) are 5-ATGAAACCCGGGTTT(...)-3'. Which of the following mutations to this original strand would be silent and which would likely only have a small effect on the coded protein? (Again, only the first 15 bases of the DNA strand are shown, even though they continue on. HINT: To solve this, you might write out the template DNA strand, the mRNA strand that would be made, and the resulting amino acids for the start of the protein.) Mutation #1: 5-ATGAAAGCCCGGGTT(...)-3' Mutation #2: 5-ATGAACCCCGGGTTT(...)-3' Mutation #3: 5-ATGAACCCGGGTTTA(...)-3' Mutation #4: 5-ATGAAGCCCGGGTTT(...)-3' Mutation #5: 5-ATGTAACCCGGGTTT(...)-3'

The first 15 bases of the original coding informational strand of DNA (which continues after what is shown) are 5-ATGAAACCCGGGTTT(...)-3'. Which of the following mutations to this original strand would be silent and which would likely only have a small effect on the coded protein? (Again, only the first 15 bases of the DNA strand are shown, even though they continue on. HINT: To solve this, you might write out the template DNA strand, the mRNA strand that would be made, and the resulting amino acids for the start of the protein.) Mutation #1: 5-ATGAAAGCCCGGGTT(...)-3' Mutation #2: 5-ATGAACCCCGGGTTT(...)-3' Mutation #3: 5-ATGAACCCGGGTTTA(...)-3' Mutation #4: 5-ATGAAGCCCGGGTTT(...)-3' Mutation #5: 5-ATGTAACCCGGGTTT(...)-3'

Name: The first 15 bases of the original coding informational strand of DNA
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The first 15 bases of the original coding informational strand of DNA (which continues after what is shown) are 5-ATGAAACCCGGGTTT(...)-3'. Which of the following mutations to this original strand would be silent and which would likely only have a sma

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

5'....TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAA actgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?
With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?
5'......TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAAactgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?
(i) (.:, From the diagram to the right of the trp repressor in its approximate binding relationship to a double-stranded DNA mole- cule, what is the relative orientation of the macrodipoles of helices 4 and 5 to each other? Indicate the N-terminal ends of helices 4 and DNA 5 5? Which residue in the sequence above is the N-terminal residue of each helix? N N (ii) :. Comparing the two protein sequences above, identify all amino acid pairs that differ in electrostatic charge due to proton dis- sociable groups (assume pH 7). Indicate the charge of both residues for each pair. C.
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?
Consider a three-base sequence in the template of DNA: 5' . . . 123 . . .3', in which 1, 2, and 3 refer to the relative positions of deoxyribonucleotides.Comment on the probable effect on the resulting protein if the following point mutations (one-base substitutions) occurred.(a) changing one purine for another in position 1(b) changing one pyrimidine for another in position 2(c) changing a purine to a pyrimidine in position 2(d) changing one purine for another in position 3
Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?
Given the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro in
Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?
Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?