The beta-pleated sheets are stabilized by hydrogen bonds among adjacent regions of the peptide backbone. O True O False
Q: Protein folding can be described as an equilbrium between an unfolded state (U) and the folded…
A: Change in Standard Gibbs free energy (∆G0') is the change in Gibbs free energy (∆G) at equilibrium.…
Q: Consider the reaction coordinate diagram shown below. X is is ;Y
A: The above shown diagram is a reaction coordinate diagram. The free energy of the system is plotted…
Q: Ph.D Fernando, Harvard Professor of Genetic Epidemiology, knows a thing or two about Twins. He must…
A: S-adenosyl-methionine: It is a typical cosubstrate used in amino-propylation, transsulfuration,…
Q: The transition state of a reaction is O easily isolated using column chromatography. by definition…
A: The completion of a chemical reaction, from the substrate to the product involves the formation of…
Q: impact on the number of electron carriers used by the electron transport chain? Select one: The…
A: Introduction Cellular respiration is of two types: aerobic respiration and anaerobic respiration.…
Q: A mixture of five proteins are analyzed by MALDI-TOF. Their molecular weigths are 3 kD, 22 kD, 100…
A: Mass spectrometry is an analytical method that involves ionizing materials into charged molecules so…
Q: Discuss the role of carbohydrates on cancer and suggest an appropriate treatment
A: Carbohydrates are biomolecules, which are the primary source of energy for the body. All of the…
Q: ● What are the three things we need to know in order to begin to understand the way an active site…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. The substrate binds…
Q: 384 Hemoglobin: Allostery and Evolution Q5.1 - 2,3-BPG is a negative allosteric regulator of…
A: Hemoglobin (Hb) is a protein that is found in red blood cells. A specific protein called haemoglobin…
Q: phosphate. Contrast the properties of hexokinases I and IV with respect to oligomeric structure,…
A: Hexokinase is an enzyme that has the ability to transfer inorganic phosphate group from ATP to the…
Q: Consider the enzyme, ATCase. All are true except: It's K effectors are ATP and CTP It is a K…
A: ATCase (Aspartate carbamoyltransferase) is an enzyme which catalyzes the first step of the synthesis…
Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…
A: AP site is Apurinic site or Abase site at which nitrogen base is lost from the nucleotide of DNA and…
Q: Problem 1: Calculate the hydrolysis of ATP at pH 7 at 37°C under steady state conditions in which…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: Please help with 2a) 2a) There are two different DNA polymerase enzymes, DNA Polymerase I and DNA…
A: Replication is the process of duplication of two strands of a double stranded DNA. In bacteria, the…
Q: is lapoamide involved in oxidation reduction..
A: INTRODUCTION : First of all there is no such proper biochemical name like Lapoamide(its incorrect) I…
Q: What mechanism of RNA regulation is responsible for the two different forms of apolipoprotein B? O…
A: Apolipoprotein B is encoded in humans by APOB gene. It is the primary apolipoprotein of VLDL, LDL…
Q: Discuss how to determine the elements of proteins and its reactions.
A: Proteins are the most abundant biomacromolecule of life. Proteins are primarily polypeptide…
Q: Consider the given data for an enzyme-catalyzed reaction. Determine the Vm, Km and the type of…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: F.28. How will phosphorylation of serine change the pKa of Arg, increase, decrease, or no change
A: Serine is a polar but uncharged residue. Arginine is a basic residue due to the presence of an amine…
Q: More energy comes out of glucose degradation if pyruvate proceeds to the mitochondria for oxidative…
A: Degradation of glucose is termed as glycolysis which is a catabolic pathway in which 6 carbon…
Q: molecule with a hydrophilic end and a hydrophobic end
A: Molecules with a hydrophobic and hydrophilic end are known as amphipathic molecules. Such molecules…
Q: Which of the following belong to the omega-6 fatty acid family? O CH3 - (CH2z - CH = CH - (CH2) -…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. If…
Q: 5. (a) Hexokinase IV is known as glucokinase (GCK) and is a central metabolic enzyme that…
A: Hexokinases: An enzyme that phosphorylates hexoses (six-carbon sugars) to produce hexose phosphate.…
Q: Search the protein data bank (https://www.rcsb.org/)and find an image of one protein that is found…
A: The SARS-CoV-2 virus is the infectious disease known as coronavirus disease (COVID-19). A group of…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: Definition of carbohydrate metabolic disorder. introduce other carbohydrate disorders along with…
A: Introduction: The term metabolism is the process by which our body makes energy from the food that…
Q: Question 12 of 25 Which of the following are characteristics of animal cells? Select the correct…
A: The somatic cell in animals undergo division by the process of mitosis. The cellular microtubular…
Q: Since higher concentration colcemid will result in shorter chromosome, you want to change your…
A: It is given that: Molar concentration of the stock solution: 10 ug/ml. Desired dilution…
Q: A binding curve for the binding of the amino acid tryptophan to the protein called TxtE is shown…
A: The binding of ligand 'L' to a protein 'P' to form Protein-Ligand complex 'PL' is represented…
Q: What is the hydrodynamic stress of bioreactors when there are cell cultures?
A: Bioreactors are vessels housing cell cultures , that provide optimum conditions for cell growth and…
Q: What are the roles of the other enzymes involved in replication and why they're necessary ?
A: Before cells divide, DNA replication must occur. DNA replication is the complete, faithful copying…
Q: Which of the different carbohydrate tests would give a positive result for maltose? Describe the…
A: Maltose is a disaccharide composed of 2 D-glucose molecules. The bonding pattern is α-1,4 . Hence…
Q: 4) For various amino acid pairs (for example: F to A, E to R, D to N, V to L, S to W), ask yourself:…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Which one of the following amino acids is phosphorylated during the process of promoter clearance by…
A: In eukaryotes RNA Polymerase II is responsible for the synthesis of mRNA. The largest subunit of Pol…
Q: The proton-motive force is a measure of the potential energy generated across the mitochondrial…
A: The catabolism of carbohydrates, fatty acids, and amino acids generates the reducing equivalents…
Q: In most enzymes, the required active site amino acids consists of only a few residues. Why is the…
A: Enzymes are proteins that function as biocatalysts and catalyse biochemical reactions.They have a…
Q: When disaccharides are heated in the presence of a strong acid, the linkage joining the two…
A: There are four types of biological macromolecules, nucleic acids, proteins, carbohydrates and…
Q: What is the experimental procedure illustrated in the figure above? What label (1-3 words) would…
A: In the given diagram, some cutting and joining of DNA is shown. In the diagram, a specific gene…
Q: 5. State whether the following statements are True or False, If False, explain why 5.1 Oxaloacetate…
A: 1. Oxaloacetate is formed by the oxidation of L-malate - Oxaloacetate is formed via oxidation of…
Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…
A: Enzymes are classified into six classes. They are oxidoreductases, transferases, hydrolases,…
Q: Use the data below to answer the following question: How much more energy is stored in a gram of fat…
A: A heterogeneous class of substances with comparatively similar physical characteristics are referred…
Q: Question 11 of 25 Among the given statements, which are characteristics of plant cells? Select the…
A: Osmosis is the process of net movement of water across a semipermeable membrane This transport…
Q: Disruption of which process will have the greatest impact on the number of electron carriers used by…
A: Disruption of which process will have the greatest impact on the number of electron carriers used by…
Q: What is the hydrodynamic stress of bioreactors when there are cell cultures?
A: Introduction A bioreactor is a vessel or manufactured device which gives biologically active…
Q: Align two sequences: horizontal - GGAATGG, vertical – ATG, m = 1, mm = 0, g = -1. Use the table…
A: Global Alignment: It is a bioinformatics algorithm used to align protein or nucleotide sequences. A…
Q: Which of the following is CORRECT? B) A "low energy compound" has a AG'° of less than -25 kJ/mol. C)…
A: catabolism and anabolism together referred to as metabolism. Breaking down if complex compounds to…
Q: In a Myoglobin and azide ligand-receptor binding experiment, instead of using 3.5 µM myoglobin you…
A: Myoglobin acts as oxygen reserve in the muscle cells. Myoglobin (Mb) has higher affinity towards…
Q: Question 24 of 25 Given the following reaction below, what amino acid is involved and what is the…
A:
Q: 9.) How many grams of H₂0 must be used to dissolve loog of sucrose (C₁2H₂2011) to prepare a 0.020…
A: Mole fraction is the ratio of moles of one component in a mixture to the total no of moles of all…
Q: How does mottling on tablets appear during drying process? Give your insights on how mottling can be…
A: Introduction During tablet processing different types of defect may arise. An tablet should be free…
Step by step
Solved in 2 steps
- The beta-pleated sheets are formed by H-bonds among adjacent regions of the peptide backbone. O True FalseThe sequence of a peptide is given below. Ala-gly-val-leu-trp-lys-ser-phe-arg-proWhich peptide bond(s) are cleaved by chymotrypsin(Attempt 8 Consider the hypothetical serine protease in the image, which shows the specificity pockets. The S1 pocket has a glutamic acid in the bottom, the S2 pocket is small and R3 H. R1 hydrophobic, and the S1' pocket is deep and hydrophobic. Suggest a 3-amino acid sequence that this protease would cleave and indicate between which sites the peptide bond R would be broken. S2 Si Which sequence would this protease cleave? O Leu-Val-Arg Arg-Val-Leu Val-Leu-Arg Val-Arg-Leu Leu-Arg-Val Arg-Leu-Val W Ma tv 894
- A tetradecapeptide (14 amino acid residues) gives the following peptide fragments on partial hydrolysis. From this information, deduce the primary structure of this polypep- tide. Fragments are grouped according to size. Pentapeptide Fragments Tetrapeptide Fragments Phe-Val-Asn-Gln-His Gln-His-Leu-Cys His-Leu-Cys-Gly-Ser His-Leu-Val-Glu Gly-Ser-His-Leu-Val Leu-Val-Glu-AlaPeptide bond structure is planar and has considerable double bond character permitting rotation about the peptide bond. True FalseA peptide has the sequence Gly-Ser-Lys-Ala-Gly-Gly-Arg-Ser-Arg. How many fragments would result from cleaving the sequence with trypsin? number of fragments: 3 Draw the smallest fragment at pH 7. + H₂N H O OH ZH N O _.. NH ₂
- Draw the structure of this peptide: N-Met-His-Tyr-Leu-Asp-Ser-Arg-Leu-CDraw out this peptide using condensed or line-bond structures: His-Thy-Phe-Cys-Glu examine your drawing of peptide for each amino acid, indicate what type(s) of interactions it can contribute to protein tertiary structure6) Circle one amino acid in this peptide (hint: draw lines between not through atoms). Kahalalide F NH HN HO NH HN HN
- Given the polypeptide chain below: Ala-Arg-Val-His-Asp-Gln 1. What kind of polypeptide is it? 2. How many peptide bonds are there?Draw the peptide formed between asparagine and histidine. H,N- -CH-C-OH H,N-CH-ċ-OH ČH2 ČH, N° NH2 -NH +"The elasticity of elastin derives from its high content of a helices, which act as molecular springs" is true or false.