Consider the reaction coordinate diagram shown below. X is is ;Y
Q: 1) Which of the following statement(s) regarding the ends of polysaccharides are true? All…
A: The biological macromolecules can be classified as proteins, nucleic acids, lipids and…
Q: What are the essential amino acids and how does the body get them? Give an example of one of them…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: The production of amino acids from proteins is an example of: a. a non-enzymatic reaction b.…
A: Proteins are large molecular weight polymers of amino acids with diverse biological functions. Many…
Q: The side chain of asparagine contains: OA) a hydroxyl group OB) an amine group OC) a carboxyl group…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Given that the reduction potential Eo'= -320, +10, +816, and +50mV for NAD+, fumarate, O₂ and…
A: An oxidizing species is the substance that donates electrons, and a reducing species is the…
Q: The following are true of the mitochondrial structure I. The inner mitochondrial membrane is…
A: Mitochondria are power house of cell, known to synthesize ATP. They are membrane bound organelles…
Q: Consider the given data for an enzyme-catalyzed reaction. Determine the Vm, Km and the type of…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Among the given statements, which ones correctly describe the commonality in dopamine and…
A: The adrenal gland secretes three catecholamines-dopamine, epinephrine and norepinephrine. Dopamine…
Q: Test I. MULTIPLE CHOICE: Read the statement carefully. use CAPITAL letters. 1. It refers to the…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: Consider the each of the amino acids in the peptide below.…
A: Amino Acids: Although the liver is the primary location for amino acid metabolism, other organs…
Q: . The book dived into allosteric enzymes and how they are regulated in metabolic pathways, but…
A: Michaelis Menten enzymes are those that follow MM kinetics. These enzymes have their reaction rates…
Q: 11. Use the data below to answer the following question: How much more energy is stored in a gram of…
A: Glycogen and fat are two molecules used by human body to store energy. The inside and even outside…
Q: Kwon Soon-young was asked by his CHEM 160.1 lab instructor to determine the isoelectric pH of an…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These…
Q: The condensation reaction catalyzed by ß-ketoacyl-ACP synthase synthesizes a four-carbon unit by…
A: Malonyl CoA is formed from carboxylation of Acetyl CoA through an ATP consuming process by biotin…
Q: What charged groups are present in glutamate at a pH = 7? OA) 1× NH3+ B) 1 x COOT C) 1× NH3 and 1 x…
A: Glutamate is an amino acid with molecular formula C5H9NO4. It is considered as acidic amino acid due…
Q: 7. What conclusion can you make about the effect of pH on the enzyme activities? Which part of the…
A: Enzymes are usually protein molecules which work as a catalyst and increases the rate of reaction by…
Q: Briefly describe the role of glycoproteins as antigenic determinants for blood groups.
A: Glycoproteins are proteins with carbohydrates attached to it. The carbohydrates that are commonly…
Q: H ОН CH2OH D H ОН H 0 البلاد - ОН H CH2OH H H ОН H 0 ОН Which of the following statements correctly…
A: The sugars often contain alcohol and carbonyl functional groups and the intramolecular hemiacetal…
Q: Select ALL of the following that are made during the Kreb's Cycle. ATP CO₂ NADH FADH2
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: b) Why might the compound shown below act as a transition state analog of phosphoglucose isomerase?…
A: Nitrogen containing transition state analogues are used to inhibit the isomerization reaction of…
Q: Which of the following statements about oxidative phosphorylation is correct? OH* ions are…
A: Introduction ATP is synthesised in the mitochondria of a cell by a process called oxidative…
Q: What is DNA? Provide a 5-sentence long description only.
A: Nucleic acids, large macromolecules are necessary for all organisms and viruses to function. The…
Q: 1a Briefly describe or explain what the term "supercoiling" means in the context of DNA structure.…
A: Supercoiling means the coiling of the coil. Cellular DNA is extremely compacted and implies a high…
Q: What does bleach do to hair
A: Melanin, the pigment that also affects the colour of your skin, also determines the colour of your…
Q: What is most correct about the following inhibition? Penicillin
A: The antibiotic penicillin irreversibly binds to and inhibits the activity of the transpeptidase…
Q: Identify if SN1, SN2 and so forth. Catabolism of triacylglycerols- beta-oxidation pathway…
A: SN1 and SN2 are common reactions in organic chemistry. SN1 is a two step reaction i.e., substitution…
Q: Events that occur in the peroxisomes incluce the following EXCEPT oxidation of fatty acids…
A: Peroxisomes are small, membrane-bound organelles in eukaryotic cells that contain enzymes involved…
Q: Question 21 of 25 What are Gram-negative bacteria? Select the correct response(s): They have a cell…
A:
Q: 6-25 For Umax 57(Kr+S) constant an enzyme that displays Michaelis-Menten kinetics, what is the…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: In ATP synthase, the ____ subunit is the site of ATP synthesis while the ____ subunit forms the…
A: Oxidation of glucose in the glycolysis and TCA cycle generates electrons carriers NADH and FADH2, As…
Q: Dehydrogenase reactions in TCA cycle
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…
A: AP sites are apuraniya sites that are created through the hydrolysis of N glycosyl bond between…
Q: A. Given the 7 proteins in the table, will they all be separated properly using isoelectric…
A: Proteins are high molecular weight biomolecules made up amino acid residues linked via a peptide…
Q: 1. The peptide below was isolated from fermented milk and shown to have antioxidant properties…
A: Peptide is polymer of amino acids linked by peptide/amide (covalent) bond with release of a water…
Q: 1. The second high energy intermediate metabolite of glycolysis that can be used for substrate level…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What is binding energy? What do negative and less negative energies represent? How does this relate…
A: Binding energy is the amount of energy required to separate a system into its constituents. If we…
Q: Question - is if the cells in our bodies were to convert the required energy into our food substance…
A: Energy must be supplied continuously for living things to exist. This energy is employed in part to…
Q: Which of the following enzymes requires Mg2+ to carry out its function? Alcohol dehydrogenase.…
A: An enzyme draws substrates to its active site, catalyzes the chemical reaction that creates the…
Q: In glycatysis, conversion of a molecule, of glucose, into 2 Molecules of Pyryvate, results in a net…
A: Glycolysis is the process of conversion of one molecule of glucose to two molecules of pyruvate. A…
Q: Use the table below to answer the question being asked: Protein Ovalbumin Insulin Fibrinogen…
A: Sodium Do-decylSulphate PolyAcrylamide Gel Electrophoresis (SDS PAGE) is a method used to separate…
Q: What is the physical or structural difference between heterochromatin (also called "heterochromatic…
A: The term "chromatin" describes the DNA and protein combination that makes up the chromosomes present…
Q: what telomerase does and why it's necessary?
A: Introduction In the nucleus the DNA molecule is packaged into thread-like structures called…
Q: What is one technique or property of a protein that you could use to monitor the fractions so you…
A: In column chromatography, there is a stationary phase and the mobile phase. The stationary phase…
Q: Among the given statements, which are characteristics of plant cells? Select the correct…
A: Plant cell has Cell wall as the outermost layer. Cell wall being the outermost layer surrounds the…
Q: In a hydrogen fuel cell, hydrogen gas and oxygen gas are combined to form water. Write the balanced…
A: Water molecule is a compound formed from hydrogen and oxygen gas. It has two Hydrogen atoms and one…
Q: 3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Which of the following belong to the omega-6 fatty acid family? O CH3 - (CH2z - CH = CH - (CH2) -…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. If…
Q: 018 You have isolated a gene that spans a total of 1800 nucleotides. The gene contains 400…
A: Genes are the sequences of nucleotides attached together through phosphodiester bonds. Genes are…
Q: Calculate the pI for the following peptide: Phe-Lys-Glu-Asp-Lys-Ser-Ala (note: there is only one…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: How many moles of ATP can be gained from the catabolism of the following substrates to pyruvate:…
A: Glycolysis is a process of breakdown of glucose to 2 molecules of pyruvate. This process also forms…
Step by step
Solved in 3 steps
- Comment on Figure 2a and Figure 2b regarding stabilization of the transition state and destabilization of ES complex during catalysis. (b) AG AG EX EX E+S E+P ES EP AG AG,+ AG- TAS ES EP Figure 2An enzymes catalyzed reaction is studied in the presence and absence of an inhibitor. The following data was obtained in the image provided. Plot 1/[S] as abscissa and 1/V as ordinate for both catalyzed reactions and reaction with inhibitor. Use the same graph for both plots Calculate the following: Km of enzyme in the reaction without inhibitor Km' of the enzyme in the reation with inhibitor Vmax of the uninhibited reaction Vmax of the inhibited reaction What kind of inhibitor was added to the enzyme catalyzed reaction? Explain your answer in terms of changes in Km and Vmax.Consider the following free energy diagram for an uncatalyzed and enzyme-catalyzed reaction. Select all the statements that are true. Without enzyme With enzyme A+B Time AB O a. The rate of the enzyme catalyzed reaction is faster than the uncatalyzed reaction O b. The change in free energy for the reaction is greater in the catalyzed reaction, compared to the uncatalyzed reaction O c. The enzyme stabilizes the transition state for the reaction Od. The reaction is exergonic е. The reaction is now spontaneous due to the addition of enzyme Released Energy
- An enzymes catalyzed reaction is studied in the presence and absence of an inhibitor. The following data was obtained in the image provided. Plot 1/[S] as abscissa and 1/V as ordinate for both catalyzed reactions and reaction with inhibitor. Use the same graph for both plots Michaelis–Menten kinetics Lineweaver–Burk plot Calculate the following: Km of enzyme in the reaction without inhibitor Km' of the enzyme in the reation with inhibitor Vmax of the uninhibited reaction Vmax of the inhibited reaction What kind of inhibitor was added to the enzyme catalyzed reaction? Explain your answer in terms of changes in Km and Vmax.Given the following enzyme catalyzed reaction, identify the class and subclass of the enzyme involved: %3D CH3CH CH,CH2 SCOA SCOA COO СОYou are working on an enzyme that obeys standard Michaelis-Menten kinetics. What variable is the V, dependant on if the concentration of the substrate is substantially higher than the concentration of the enzyme? [S] [E] [ES] O [P] O not enough information provided
- A biochemical reaction transfers 60 kJ mol-1(15 kcal mol-1) of energy. What general process most likely wouldbe involved in this transfer? What cofactor (or cosubstrate) likelywould be used? Which cofactor probably would not be used?Consider the following free energy diagram for an uncatalyzed and enzyme-catalyzed reaction. Select all the statements that are true. Without enzyme With enzyme A+B Time AB Oa. The reaction is now spontaneous due to the addition of enzyme b. The rate of the enzyme catalyzed reaction is faster than the uncatalyzed reaction O C. The reaction is exergonic O d. The change in free energy for the reaction is greater in the catalyzed reaction, compared to the uncatalyzed reaction e. The enzyme stabilizes the transition state for the reaction Released Energy pesthe kinetics of an enzyme were analyzed in the absence of inhibitors, as well as in the presence of inhibitor A and inhibitor B. Using the given data below, construct or calculate the following (make sure the label graphs with appropriate axes and equations, and circle final answers) plot 1[S] as abscissa and 1/v as ordinate for both catalyzed reaction and reaction with inhibitor. Use the same graph for both plots Calculate the; Km of enzyme in the reaction without inhibitor Km of the enzyme in the reaction with inhibitor (A dnB) Vmax of the uninhibited reaction Vmax of the inhibited reaction (A and B) What kind of inhibitor (A and B) was added to the enzyme-catalyzed reaction? Explain in terms of changes in Km and Vmax
- Enzyme X and enzyme Y catalyze the same reaction and exhibit the νo versus [S] curves shown below. Which enzyme is more effi cient at low [S]? Which is more effi cient at high [S]?Would you expect an “enzyme” designed to bind to its target substrate astightly as it binds the reaction transition state to show a rate enhancementover the uncatalyzed reaction? In other words, would such a protein actuallybe a catalyst? Explain why or why not.What are the benefits of measuring the initial rate of a reaction Vå for use in kinetic studies? (This is a multi-select question). [ES] can be measured accurately. changes in [S] are negligible, so the value of [S] is known. changes in Km are negligible, so Km can be treated as a constant. V₁ = Vmax. --> A negligible amount of product has formed, so that the back reaction P -- need not be considered. ES