So if you see growth on a histidine-deficient medium in a yeast 1 hybrid and you assume that it is a false positive. What could have caused this? The yeast cells are normal and this wasn't caused by other molecules.
Q: If ox ale acctate, the molecule that starts with Acetyl- CoA in the citric at id cych, is not a…
A: Oxaloacetate and its effect on cellular respiration.
Q: The _was one of the first standardized ways that ancient human ancestors produced tools and was used…
A: Introduction Human evolution:- It is the lengthy process by which human beings developed on Earth…
Q: In a population, describe the result of inbreeding. Whether inbreeding leads to the change in the…
A: Introduction Inbreeding occurs when closely related organisms mate. Inbreeding is also defined as an…
Q: Which muscle cells would you use more of, if you train to run a marathon? O Slow twitch cells O Fast…
A: There are three types of muscle - A. Skeletal muscle - Voluntary and striated. B. Smooth muscle -…
Q: Q16. How many differentially expressed genes can you identify using only 1 sample in each group and…
A: Gene expression is the process by which information from a gene is used in the synthesis of a…
Q: Autosomal Dominant is a mutation in one copy of the gene. It is inherited from an affected parent or…
A: One of the ways a genetic trait or a genetic condition can be inherited. In autosomal dominant…
Q: What is an Ecological Risk Assessment and what are its uses?
A: Q. What is an Ecological Risk Assessment and what are its uses.
Q: Writing a Full Strand: 1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT…
A: DNA It is a nucleic acid which carries genetic information that gets passed from one generation to…
Q: Which assumption below is not required for Hardy-Weinberg equilibrium? Random mating O Large…
A: The Hardy-Weinberg equilibrium is a principle stating that the genetic variation in a population…
Q: Because the Laetoli footprints date to 3.6 mya and they are clearly made by a bipedal hominin, it is…
A: Introduction Bipedalism:- It is a form of terrestrial locomotion where an organism moves by means of…
Q: What do young herring gulls want when they peck the red spot on their parents' bills?
A: Pecking is a specialised behaviour in words suggesting that they need something. These birds are…
Q: What is the effect of the absence of the leaving group (acetomethoxy) at the position 3 and…
A: The presence of a leaving group at the 3'-position of a beta lactam antibiotic can lead to the…
Q: QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence…
A: Abrupt changes in the DNA sequences are called mutations. these may or may not change the protein…
Q: Question: How are amino acid precursors obtained from fatty acids? Show the pathway clearly
A: Introduction The breakdown or storage of fats for energy, as well as the production of structural…
Q: Q12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: Flatworms, also known as flatworms, Platyhelminthes, or platyhelminths, are a phylum of bilaterian,…
Q: Hominins differ from hominids in that they have larger brains. True O False
A: Human evolution is the evolutionary process that led to the formation of Homo sapiens as a unique…
Q: Which embryonic germ layer lines the outer surface of the embryo
A: An embryo is the early stage of human development in which organs form critical body structures.
Q: The bacterial cultures for the industrial fermentation process need to be maintained in an…
A: Exponential phase - Following a period during which the growth rate of the cells gradually…
Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…
A: Introduction: The coat of calico cats is tricolour. They are females because their colouring is tied…
Q: Describe the differences in the muscularis mucosa as you descend the esophagus and give the function…
A: The digestive system consist of alimentary canal and its glands in gastrointestinal tract.The…
Q: The lungs perform other :physiologic functions Play secondary role in heat exchange and fluid…
A: The lungs are a crucial organ of the body. They are quite spongy and are filled with air with the…
Q: Elaborate the types of molecules and in which direction (from blood to tubules or tubules to blood)…
A: Nitrogenous wastes are formed inside all the body cells. These wastes are transported into the…
Q: What is the importance of feedback systems in the control of hormonal output in mammals? Offer two…
A: Introduction Hormones are chemical compounds that function in the body as messenger molecules. They…
Q: QUESTION 1 You are studying a mutant strain of e.coli. When you add lactose to the media of this…
A: Lac operon is the segment of DNA which is involved in the breaking down of lactose into glucose in…
Q: is the study of the process of what happens to biological remains after an organism dies. This is…
A: Fossils are preserved remains of an organism that has been died in the past . The process of…
Q: Label the parts of the avian skeleton
A: Aves Aves are the vertebrates group that includes birds. They evolved from reptiles. Some examples…
Q: DRAW A LOCAL FOOD WEB AND IDENTIFY THEIR NAMES
A: A local food web depicts the connections between food producers, retailers and consumers. The…
Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…
A: Retention signal which are KDEL and KKXX sequences acts as a signal indicating the sorted out…
Q: Dominant trait: H (high metabolism) Recessive trait: h (normal metabolism) Possible Genotypes:…
A: Introduction "Genotype" refers to an organism's complete genetic information. The observed traits of…
Q: Citing data from the results table, tell which antibiotic is most effective against this type of…
A: Antibiotic zone of inhibition Antibiotics are a class of compounds or chemical that inhibits the…
Q: Homo is a recently discovered hominin found in southeast Asia. Current evidence suggest that it may…
A: hominin, any member of the zoological “tribe” Hominini of which only one species exists today—Homo…
Q: Elucidate the fundamental challenges the aquatic vertebrates and terrestrial vertebrates face in…
A: Terrestrial vertebrae The human excretory system removes waste from the body through sweat, the…
Q: What made the pepper on water move upon the addition of the dishwashing liquid?
A: Water molecules are composed of two hydrogen molecules covalently bonded to one oxygen molecule.…
Q: Discuss all the importance of epithelium found in the digestive tract.
A: Human digestive system The digestive system of the human body comprises a group of organs working…
Q: Energy and cellular functions: The evolution of the Prokaryotic cell type into the Eukaryotic cell…
A: Chloroplasts are structure exclusive to the eukaryotic organisms. This was an important development…
Q: Describe or draw the process of creating a vesicle from an ER membrane OR fusing a vesicle with the…
A: A vesicle is a tiny cell structure made up of fluid and a lipid bilayer. Exocytosis, phagocytosis,…
Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…
A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…
Q: Isabella, 28, andOmar, 30, have been together for three years. A year ago, they decided they wanted…
A: Fertilisation: Fertilisation occurs when a sperm fuses with the female egg after the intercourse…
Q: The "heart" of an insect, is located in the [blank] and is known more technically as the [blank]: a)…
A: An insect has mainly three parts; head, thorax, and abdomen. The insects have an open circulatory…
Q: Increasing environmental temperature has which of the following effects on mosquitoes and arthropod…
A: ANSWER;-c) The frequency of blood-feeding by females increases.
Q: Which statement about correlation and causation is true? (a) A correlation is never a causation.…
A: Introduction: There is a link or pattern between the values of two variables when they are…
Q: importance of feedback systems in the control of hormonal output in mammals? Offer two examples of a…
A: Feedback system A feedback system is a loop that controls the body and regulates it to either move…
Q: Hypercholesterolemia is caused by a defect on chromosome 19 and a mutation of LDL receptor. The…
A: Cholesterol Cholesterol is a fat-like waxy substance found in the blood which is necessary for our…
Q: List and define twenty branches of zoology including their etymology.
A: Introduction Zoology is the study of all living and extinct animals, including their anatomy,…
Q: if you are going to prepare 15 plates of Nutrient Agar, 30 NA slants, and 20 NA stabs, how much tap…
A: In usual labs petriplatea can hold 15ml of media therefore for 15plates approximately 15×15 = 225ml…
Q: This blood vessel carries blood away from the heart. O A. Artery O B. vein O C. venule O D.…
A: Blood circulate throughout your body with the help of certain vessels known as blood vessels. Thus…
Q: Which of the following is least likely to produce genetic variation in the offspring of an…
A: Genetic variation is the changes in the genes of offspring from the parents. Meiotic cell division…
Q: In the presence of lactose and the presence of glucose the lac operon is V [ Select ] Lacl is […
A: An operon is essentially a gene regulatory system in which a collection of genes coding for…
Q: To determine: The special properties that an enzyme isolated from a psychrophilic bacterium will…
A: Introduction Proteins that operate as biological catalysts are known as enzymes. Chemical reactions…
Q: What are some of the applications of animal reproduction and development in the real world?
A: Animal reproduction & development is one of the important aspect of animal life. Every organism…
Step by step
Solved in 2 steps
- Draw a diagram/figure to explain the conjugation process (e.g. use PowerPoint or draw one by hand and include a photo of it). You should include in the diagram the F- recipient, Hfr Donor and the transconjugant/recombinant recipient. Make sure to include the genes encoding for Leucine, Threonine, Thiamine and Streptomycin resistance in your diagram. How does an Hfr strain of coli transfers chromosomal DNA to an F- strain? What determines how much of the chromosomal DNA is transferred?In your laboratory, you have an F − strain of E. coli that is resistant to streptomycin and is unable to metabolize lactose, but it can metabolize glucose. Therefore, this strain can grow on media that contain glucose and streptomycin, but it cannot grow on media containing only lactose. A researcher has sent you two E. coli strains in two separate tubes. One strain, let’s call it strain A, has an F factor that carries the genes that are required for lactose metabolism. On its chromosome, it also has the genes that are required for glucose metabolism. However, it is sensitive to streptomycin. This strain can grow on media containing lactose or glucose, but it cannot grow if streptomycin is added to the media. The second strain, let’s call it strain B, is an F − strain. On its chromosome, it has thegenes that are required for lactose and glucose metabolism. StrainB is also sensitive to streptomycin. Unfortunately, when strains A and B were sent to you, the labels had fallen off the…The figure below shows a partial chromosome map of an E. coli Hfr strain. Each mark = 10 minutes between conjugation transfer time. If transfer of genes begins at “*” relative to the origin of transfer, what is one of the predicted results from this map? It would take less than 30 minutes to transfer all of the genes that are shown. gal and azi will rarely be transferred together. gal and ton will rarely be transferred together. Ten minutes after transfer of ton, lac will be transferred. This strain will produce very few gal recombinants.
- An Hfr strain that is leuA+ and thiL+ was mixed with a strain thatis leuA− and thiL−. In the data points shown in the following graph,the conjugation was interrupted at different time points, and thepercentage of recombinants for each gene was determined bystreaking on a medium that lacked either leucine or thiamine.What information do you know based on the question and your understanding of the topic?You are studying a microorganism that contains a chloramphenicol acetyltransferase (CAT) enzyme, and looking for a clone of this microorganism that no longer contains the gene encoding CAT. Imagine you had an LB plate containing chloramphenicol. You streak an isolated colony of the Parent Strain and Clone A onto the same plate. Which of the following statements are true about the growth pattern after 24 hours in the incubator? Select all that apply? L-hlareeheticol LB chloremphenicel Parent Clune A Parent Clone A LD chlerephenicol 18 chloremphenitol Paremt Clone A Paront Clone A Plate A is the expected growth pattern as clone A should grow in the LB plate with chloramphenicol Plate B is the expected growth pattern as LB plate with chloramphenicol parent strain should grow in the Plate B is the expected growth pattern as clone A should not grow in the LB plate with chloramphenicol Plate A is the expected growth pattern as the parent strain should not grow in the LB plate with…Two auxotrophic triple Escherichia coli strains (A: met- phe- ade- val+ bio+ thr+ and B: met+ phe+ ade+ val- bio- thr-) are mixed in LB liquid medium, diluted and then spread on LB solid rich medium. Six colonies are observed: Then, replicates are performed on 6 different media (minimum medium + glucose + indicated substances). The results are shown below. Determine the genotype of the 6 colonies observed. Which ones are from strain A? From strain B? Which hypotheses can explain these results and which one do you prefer? met phe val bio Abbreviations: met ade val thr phe ade bio thr Met: methionine; Phe: phenylalanine; Ade: adenine; Val: valine; Bio: biotin; Thr: threonine.
- The following recombinants are recovered when conjugation occurs between an a*d*g+ donor and an adg recipient. at d+ g+ = 84% a d g+ = 6% at d g+ = 10% a dt g+ = less than 1% What is the map distance between the a and d genes? 10 map units 74 map units less than 1 map unit 84 map units 6 map unitsYou have conducted a transposon mutagenesis experiment using the same PRL27 system that was used during your lab exercise. After allowing for conjugation. you plate the conjugation mix on Luria agar and Luria + Kanamycin agar. After incubation, you count the following number of colonies on each type of plate: Media Dilution Number of Colonies Too Many to Luria 10-5 Count 10-6 173 10-7 28 Luria + Kanamycin 100 324 10-1 217 10-2 3 Determine the transformation efficiency. Note: You can enter you answer using long form (e.g. 1500000) or scientific notation using e notation (e.g. 1.5e6). Do not enter units.An Hfr strain that is leuA+ and thiL+ was mixed with a strain thatis leuA− and thiL−. In the data points shown in the following graph,the conjugation was interrupted at different time points, and thepercentage of recombinants for each gene was determined bystreaking on a medium that lacked either leucine or thiamine.Make a calculation.
- An Hfr strain that is leuA+ and thiL+ was mixed with a strain thatis leuA− and thiL−. In the data points shown in the following graph,the conjugation was interrupted at different time points, and thepercentage of recombinants for each gene was determined bystreaking on a medium that lacked either leucine or thiamine.What is the map distance (in minutes) between these two genes?) In a conjugation experiment, we used two strains: Hfr: streptomycin sensitive and F-: auxotrophic for isoleucine and threonine, streptomycin resistant. If we interrupt conjugation when only threonine gene has been transferred and spread this mixture on: Minimal media, Minimal media with streptomycin Minimal media with threonine and streptomycin Minimal media with isoleucine and streptomycin LB agar plates with streptomycin On which plates do we expect bacterial growth? Why?A panel of cell lines was created by human–mouse somatic-cell hybridization. Each line was examined for the presence of human chromosomes and for the production of an enzyme. The following results were obtained:
