Question 4 Which is/are NOT true of protein isofor (A They have variable amino acid B They have identical base seque they are the result of alternativ
Q: Biochemistry Question: Nonenzymatic glycosylation or glycation creates glycoproteins by
A: Glycoproteins are molecules that comprise protein and carbohydrate chains that are involved in many ...
Q: Lecithins and cephalins are both
A: Lecithin are mixture of glycerophospholipids like phosphatidylcholine, phosphatidylethanolamine, pho...
Q: The glycerol-3-phosphate shuttle can transport cytosolic NADH equivalents into the mitochondrial mat...
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since yo...
Q: GIVEN: Centrifuge A: rotor radius - 5 cm; max. speed - 4,000 xg Centrifuge B: rotor radius - 7 cm; m...
A: Centrifuge is a device used for separating molecules having different densities. The process is call...
Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA GA...
A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by...
Q: The enzyme is considered to be alan* COO COO H-C-OH Phosphoglyceromutase H-C-0- ČHO-P ČH,OH 3-Phosph...
A: Enzymes are classified as oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases...
Q: B. Number of milligrams of KOH required to neutralize fatty acid present in 1 g of fat is called. A....
A: A group of organic compounds includes lipids that are insoluble or poorly soluble in water. l...
Q: 50 Which best describes the role of FADH2 in aerobic metabolism? O FADH2 is a proton shuttle and tra...
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic p...
Q: Choose among proteins A, B, C, and D. 1. Protein that will most strongly bind to an anion exchange ...
A: Chromatographic techniques are used to separate specific molecules from a mixture of different molec...
Q: The main role of carbohydrate in the cell membrane is ____ Select one: a. recognition b. reception c...
A: Carbohydrates are composed of carbon, hydrogen, and oxygen in the ratio of 1:2:1. Carbohydrates are ...
Q: Which of the following chromatographic techniques allows a faster elution of polar proteins? O Hydro...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial...
A: Vmax is the reaction's maximum speed at which all of the enzymes become saturated with the substrate...
Q: Analysis of a octapeptide revealed the presence of the following products: 2 Arg, 1 Gly, 1 Met, 1 Tr...
A: Edman Degradation – This is method of peptide sequencing. In this method amino terminal residue is l...
Q: Given the following reaction, identify the class and subclass of the enzyme involved. ÇH2OH CH2OPO,²...
A: The enzymes can be classified based on the type of reaction that is catalyzed. The enzyme classes ar...
Q: Which of the following statements regarding size exclusion chromatography is false? During siz...
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first...
Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial...
A: From the above data, S1 = 0.0.3 mmol/L km is around 0.06 mmol/L Initial velocity V01 = 1.5*10-3 V0...
Q: An infant with corneal clouding has dermatan sulfate and heparan sulfate in his urine. Decreased act...
A: Introduction: The syndrome is also known as mucopolysaccharide type I (MPS I). It is an autosomal r...
Q: Please provide a chromatography technique to isolate the protein A from the mixture containing prote...
A: Protein A :- positively charged Protein B :- negatively charged For separation of charged molecules ...
Q: Give one example of 5-Carben Sugar
A: A sugar is a polyalcohol that has had at least one of its constituent alcohols oxidized to an aldehy...
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...
A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...
Q: Propose a reasonable biosynthesis for Compound 14. MUST BE in this order: Acetyl CoA SAM S-alanine S...
A: Here compound 14 is synthesized from L-Phenylalanine, SAM, L-alanine, and Acetyl-CoA in multistep p...
Q: Study the given structures below. Which of the following are enantiomers?" -OH но- H- HO- но- HO- но...
A: Enantiomers are the molecules that are exactly mirror images of each other. They cannot be superimpo...
Q: Draw and name the covalent linkage between two deoxynucleotides. Indicate both the 5’ and 3’ end. Yo...
A: Deoxyribonucleotides are the smallest units present in DNA. DNA is also known as deoxyribonucleic ac...
Q: Draw the structure of following peptide: Glu-Asp-His-Cys-Gly-Arg (B) At pH= 10.7 (A) At pH= 2.1
A: Amino acids are organic compounds having two functional group namely carboxyl and amino. Amino acids...
Q: H2O2 + catalase = 2 H2O2 + O2, is an example of what enzyme specificity? * A. Stereochemical B. Gr...
A: Catalase react with h2o2 and gives water and oxygen
Q: Branched polysaccharides will be more viscous than linear polysaccharides. True False
A: The molecular formula of glucose is C6H12O6. Glucose is a building block of disaccharides like ...
Q: 1. The overall charge of this protein at pH 7 is Drop-down answer choices are [positive, negative, o...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: 1. Which of the following molecule can act as molecular chaperons for assisting the folding of prote...
A: A broad set of unrelated protein families whose function is to stabilise unfolded proteins, unfold t...
Q: His + Asp +Arg will engage this specific interaction * A. Hydrogen Bonding B. Disulfide Bonds C. N...
A: Introduction: Proteins are building blocks of life and they are made up of carbon, hydrogen, oxygen...
Q: The cell concept CANNOT apply to ____
A: Cell theory (a unifying principle of biology) was formulated by Schleiden and Schwann. Cell theory s...
Q: Match the following structural composition of each polysaccharide with its identity ...
A: Polysaccharides, also known as polycarbohydrates, are the most abundant carbohydrates found in food....
Q: Colchicine is used to treat gout. It alters cytoskeleton function. Why do you think it is useful for...
A: Gout is a frequent and complicated form of arthritis that can strike anyone at any time. It's charac...
Q: ummarize what happens during protein processing
A: To be functional, all freshly produced polypeptides must be folded into their three-dimensional stru...
Q: Which of the following factors favors the formation of the Random DNA Coil? a Enthalpy b Bas...
A: Some parts of the protein chain do not form regular secondary structure or have a consistent hydroge...
Q: Lysine is similar to ornithine. .Why does lysine not form a lactam? a. Infrequency of lysine occurr...
A: A lactam is a cyclic amide (lactone+amide). A lactam antibiotic is an antibiotic that contains a β-l...
Q: Show the relationship between lipids, nucleic acids, proteins, and carbohydrates including the conne...
A: A biomolecule, also called a biological molecule, is a chemical compound found in living organisms. ...
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They...
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. Allosteric enzymes are th...
Q: 1. Draw NEW amino acids; name them and characterize them 2. Make two dipeptides with your two new am...
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines...
Q: Which of the following statements is NOT TRUE about tyrosine? O It is an essential amino acid. O It ...
A: OPTION A: Tyrosine is a non-essential amino acid as the body makes it from phenylalanine. OPTION C:...
Q: A pyrimidine(s) with a H-bond acceptor its middle position is/are a Cytosine b Uracil c ...
A: Hydrogen bond donor is the atom that do not provide a hydrogen atom for hydrogen bonding. They mig...
Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH,OPO,2- CH,O...
A: Enzymes are biocatalysts that speed up biochemical reactions. These are mainly three dimensional glo...
Q: Compare and contrast antibiotic and antiviral treatments. Analyze how different antiviral therapies ...
A: Antibiotics are the group of antimicrobial substances which are used to inhibit or to destroy any mi...
Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed f...
A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of th...
Q: In the 1step of the 2-step reaction shown below, which substrate/co-substrate is being oxidized? ...
A: The above reaction is a part of beta oxidation of fatty acid process.
Q: An a strain of yeast that cannot switch mating type isisolated. What mutations might it carry that w...
A: Yeast is a kind of organism that lives Saccharomyces cerevisiae is a single-celled eukaryote that ma...
Q: The transcription of a gene called YFG (your favoritegene) is activated when three transcription fac...
A: An enhanceosome is a group of trans-acting factors that assemble at an enhancer region of a gene to ...
Q: The lock-and-key theory described the action of ______. Select one: a. enzymes as locks that fit oth...
A: Lock-and-key theory describes the formation of an enzyme substrate complex. The complementarity betw...
Q: Which of the following is NOT a unit of concentration? All of these options are units of conce...
A: The specific activity is the activity of the enzyme present per milligram of the total enzyme.
Q: human blood plasma contains all the amino acids
A: here they are talking about amino acids present in blood plasma . so our blood plasma contains alan...
Q: Which of the following is a drawback of using base hydrolysis during amino acid composition? O Proto...
A: A protein is consisted of several amino acids bond together in sequence with peptide bond. To analyz...
Step by step
Solved in 2 steps
- Question 7 Review translation. Match the term and its description. Each term can only be used once. transfer amino acids to the growing polypeptide in a ribosome |Choose | these base-pairs of a ERNA with a complementary codon on MRNA [ Choose J The two ribosomal subunits (large and small) are made of proteins | Choose | and this RNA called >Question 2 Match the term and its description. Each term can only be used once. a series of nonoverlapping, three-nucleotide words [Choose J This DNA strand provides a template for ordering the sequence of complementary nucleotides in an RNA transcript | Choose ) the MRNA base triplets [ Choose J Codons must be read in the correct groupings in order for the specified polypeptide to be produced. These correct groupings are [ Choose J called > > > >QUESTION 21 Suppose the following are sequences at the 5' splice junction and the 3' splice junction, with intervening intron sequences shown as dashes and the branchpoint A shown, not surprisingly, as 'A'. What is the sequence formed after splicing? 5'-CUCAAUGGUACA- -----CGAUACGAGCACUGACC-3' O A. 5' CUCAAUGCACUGACC 3' O B. 5' CUCAAUGACC 3' O C. 5' CUCAAUGGGCACUGACC 3' O D. 5' CUCAAUGGUGACC 3' O E. 5' CUCAAUGGUACACGAUACGAGCACUGACC 3'
- Question 4. Imagine the main chain of a protein bends back on itself so that two amino acid residues R1 and R2 come close to each other. In the table below are four possibilities for what R1 and R2 might be. In each case, decide whether a specific interaction could form between the residues. If a specific interaction could form, give the name of the interaction. R₁ cysteine tyrosine threonine arginine R₂ cysteine phenylalanine glutamine aspartate specific interaction? OO yes O yes O no no OO O yes no yes no name of specific interaction 0 П 0 0Question 9 Review translation. Which step is not a part of elongation cycle of translation? O binding of small ribosomal unit to MRNA O codon recognition O peptide bind formation O transloationQuestion one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the MRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar). B (Ctrl) -
- QUESTION 9 Which of the following step is NOT involved in eukaryotic MRNA synthesis? O Elongation O Polyadenylation O Rho-dependent termination Splicing CappingQuestion 16 What happens when a stop codon is reached by a ribosome? A termination tRNAter binds to the codon and the growing peptide is transferred to it. When the peptidyl-tRNAter A reaches the P site, the ribosome is signaled to release the protein. The ribosome then is likely to dissociate. A termination tRNAter binds to the codon and the growing peptide is transferred to it. When the peptidyl-tRNAter (B) reaches the P site, the ribosome dissociates. A separate peptidyl transferase then releases the protein from tRNAter. A termination tRNAter binds to the codon and is used to release the growing peptide from the P site TRNA. The ribosome then is likely to dissociate. D A release factor binds to the codon and is used to release the growing peptide from the P site tRNA.P Question 16 Two peptides have almost the exact same primary structure, except that one has about 10 fewer amino acids at the amino-terminus (N-terminus) of the protein. What is a possible explanation for the protein that is missing those 10 amino acids? O A. An alternative Poly-A tail addition site O B. Leaky scanning occurred O .Differential glycosylation of the protein O D. Inefficient folding by chaperone proteins O E. All of the above are correct answers
- Question 10 Which of the following is required for RNA splicing to occur? A) a cyclic phospodiester at the 3' end of the RNA molecule B a2' hydroxyl group (c) the enzyme splicase D a free 5 hydroxyl created by hydrolysis of the phosphate ester bondQuèstion 2 Which example is describing a "missense" mutation? O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated alele produces an amino acid sequence Met-Ala-Phe-Tyr OThe normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-STOP O The normal amino acid sequence of a protein is Met-Ala-Phe-Tyr and the mutated allele produces an amino acid sequence Met-Ala-Phe-Leu AMoving to the next question preinQuestion 10. A mRNA contains a codon with the sequence 5'-GAA-3'. Answer A and B for credit. A. What amino acid is encoded by this codon? B. What would be the most likely sequence of the anticodon in the tRNA that recognizes it? Write your answer starting with the 5' end and include 5' and 3' in your answer to get credit.