Q14. An insertion has occurred within the sixth codon of an mRNA sequence during transcription. What is the state of the first, third, seventh and tenth amino acids after translation has occurred? What could be the effect of this mutation on the resulting polypeptide if it is intended to be 100 amino acids long?

Q14. An insertion has occurred within the sixth codon of an mRNA sequence during transcription. What is the state of the first, third, seventh and tenth amino acids after translation has occurred? What could be the effect of this mutation on the resulting polypeptide if it is intended to be 100 amino acids long?

Name: Q14. An insertion has occurred within the sixth codon of an mRNA sequ
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Q14. An insertion has occurred within the sixth codon of an mRNA sequence duringtranscription. What is the state of the first, third, seventh and tenth amino acids aftertranslation has occurred? What could be the effect of this mutation on the resul

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 11TYK: Discuss Concepts A mutation occurs that alters an anticodon in a tRNA from 3-AAU-5 to 3-AUU-5. What...

See similar textbooks

Similar questions

A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
A.C. 3.4 Q1. Protein synthesis is carried out by the processes of transcription and translation. A short length of DNA is shown: TACTCGTCGACGATGATC First base (a) State how many codons are present. (b) Using the table below, find the sequence of amino acids resulting from the transcription and translation of the length of DNA. Show your working. U U UUU Phenyl- UCU UUC alanine F UCC UCA -Leucine Lucc UUG-Le G CUU CUC CUA CUG A AUA -Leucine L AUU I AUC Isoleucine Methionine start codon AUG MMet GUUT GUC GUA GUG -Valine V CCU CCC CCA CCG ACU ACC ACA ACG C GCUT GCC GCA GCG Second base -Serine S -Proline P -Threonine -Alanine UAUT UAC A UAA UAG CAU CAC CAA CAG A Tyrosine Y Stop codon Stop codon -Histidine H -Glutamine AAA TAAG-Lysine AAC-Asparagine N GAU Aspartic GAC acid D GAG Glutamic G UGU-Cysteine C E UGC UGA UGG AGU AGC KAGG-Arginine CGUT CGC CGA CGG GGUT GGC GGA GGGJ Stop codon A Tryptophan -Arginine R Serine S R Glycine UCAG G SCAG SCAQ SCAG Third base
Which statements are true? Explain why or why not.1 The consequences of errors in transcription areless severe than those of errors in DNA replication.2 Since introns are largely genetic “junk,” they do nothave to be removed precisely from the primary transcriptduring RNA splicing.3 Wobble pairing occurs between the first positionin the codon and the third position in the anticodon.4 During protein synthesis, the thermodynamics ofbase-pairing between tRNAs and mRNAs sets the upperlimit for the accuracy with which protein molecules aremade.5 Protein enzymes are thought to greatly outnum-ber ribozymes in modern cells because they can catalyzea much greater variety of reactions and all of them havefaster rates than any ribozyme.
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
Discuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is transcribed, the result is the following mRNA molecule: In a mutated form of the gene, two extra base pairs (underlined) are inserted: What effect will this particular mutation have on the structure of the protein encoded in the gene?
Discuss how degeneracy of the genetic code makes cells more robust to mutations.
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
What processing step enhances the stability of pre-tRNAs and pre-rRNAs? methylation nucleotide modification cleavage splicing
Contrast transcription and translation. Name at least three differences between the two processes.
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?
Q14: The figure below shows a ribosome in the process of translating an mRNA with the sequence: 5'..AUGCCGUAUGCUCUUUA...3' Elongation 3 5 3 3 LAUGEEGUAUGCU UACGGC CG AUGC EUT P sitez UAC A site A Met Pro Pro Met Anticodon Met Amino Incoming- tRNA terminus Pro © 2001 Sinauer Associates, Inc. The right side shows the ribosome with an empty A site aligned with the codon 5’UAU 3’. The next tRNA to occupy the A site on the ribosome will have what anti-codon sequence ( label 5' and 3’)? Keep in mind the wobble pairing rules and make sure your answer is consistent with the genetic code. Explain your answer. а. b. Suppose, just as the ribosome started translating the mRNA, the cell suddenly lost all of its alanine tRNAs. Using the figure above as a guide, draw and label the state the ribosome would arrest in.
Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.