Please check all the proteins that would likely have a nuclear localization sequence: Histones TATA Binding Protein Type I Hormone Receptors Type II Hormone Receptors
Q: 5. Reciprocal regulation of glycogen phosphorylase and glycogen synthase activity.
A: Enzymes are proteins that aid in the speeding up of chemical reactions. Enzymes bind to substrates,…
Q: What would be the effect of a visualizing agent on the retention factor. Rf? A.Higher Rf B.Lower RF…
A: Visualising agent: The chemical agents that can be used to detect the number and location of the…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: 1. What role do eicosanoids play in the body? What is the primary fatty acid in their composition?…
A: INTRODUCTION : Eicosanoids - They are classified as a group of molecules which are being derived…
Q: The enzyme phosphoglucomutase catalyzes the conversion of glucose 1-phosphate to glucose…
A: Phosphoglucomutase is the enzyme that catalyze the interconversion between glucose 1-phosphate (G1P)…
Q: Which of the following statements is correct regarding the structures below? CHO CHO но-н H H-OH ОН…
A: Carbohydrates can be classified into different types depending on their size into the following…
Q: How many ADP molecules are phosphorylated as electrons of cytosolic NADH enter the mitochondria via…
A: Most textbooks mention that under aerobic conditions, NAD+ is regenerated in the ETC. But the…
Q: An equilibrium dialysis study was carried out with a ligand binding receptor protein. The protein…
A: Scatchard plot is a very useful plot to determine the affinity of association of ligand and a…
Q: Xylulose and ribulose are epimer pairs. Please explain why and how to identify epimer pairs
A: Epimers are the simple Sugars that differ in a single chiral centre or in the arrangement of OH…
Q: Calculate the number of moles of ATP produced from the complete oxidation of 900 g glucose in the…
A: Glucose that enters the cell produces ATP by respiration. The processes involved are glycolysis,…
Q: Question 5 An a-helix has the sequence: NH3-Ser-Glu-Gly-Asp-Trp-Gln-Leu-His-Val-Phe-Ala-Lys-Val-Glu-…
A: Alpha helix is a type of secondary structure of proteins. It is the rod-like structure formed when…
Q: I. II. III. IV. O HẲN-CH-CANH-CH,C-NH-CH-CƠ V. O CH3 alanyl 2. Types of protein structures: What is…
A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: Are there anymore features that limit the protein configurations?
A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…
Q: true/false: Pepsin cleavage of the peptide Ala-His-Gly-Trp-Val-Ile-Arg-Gly would yield the…
A: Pepsin is a proteolytic Enzyme that cleaves the peptide bonds with specificity. This can be used in…
Q: c) 1.0 1.2 Estimate Vmax and KM for all cases. What type inhibitor is [I]? Estimate K₁ and/or Kı'…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: 14. Consider the molecules below and the answer questions that follow. CH-0-8-R₁ HC-0-C-R₂ 0-4-0-0₂…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…
A: Purification is a process by which impurities are removed from a sample and desired component is…
Q: Elongation of fatty acids chains beyond 16 carbons takes place: on the membrane of the endoplasmic…
A: Acetyl CoA from glucose oxidation or other anaplerotic reactions is produced in mitochondria and…
Q: Report Table PP.7: Ninhydrin test Analysis of results for the Ninhydrin tests Glycine Tyrosine…
A: Proteins are folded peptides. Peptides are made up of amino acid residues linked via a peptide bond.…
Q: a. What hormone is released in response to increased blood glucose? 2. b. The binding of this…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Complex proteins-enzymes, their components. Prosthetic groups of complex protein-enzymes…
A: Complex proteins-enzymes have wide applications in metabolic activities and have many physiological…
Q: Name four amino acids that can be synthesized using pyruvate as a starting material. What one(s) of…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Mucic Acid Test for Galactose and Lactose Galactose, on being oxidized with HNO3 forms mucic acid,…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified into monosaccharides,…
Q: When muscle is at rest, creatine phosphate is produced from ATP in order to store energy. What is…
A: Most of the time, certain cellular reactions are highly endergonic reaction, that is they are…
Q: At pH 10, what is the net charge of the peptide Asn-His-Glu-Cys-Ser-Lys?
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: What statement is true regarding LDL? Because the LDL is plasma lipoproteins with a lipid bilayer,…
A: Lipoproteins are triacylglycerols, phospholipids, cholesterol, and cholesterol esters associated…
Q: Substrate phosphorylation in the tricarboxylic acid. (TCA)
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Classify the diluents use with respect to their osmotic pressure in relation to their contents of…
A: Cell membranes are semipermeable barriers, and osmotic gradients between intracellular and…
Q: Examine the membrane lipid pictured below and answer the following questions: a. Is this lipid…
A: Fatty acids are carboxylic acids with a hydrocarbon chain. Fatty acids may be saturated or…
Q: Explain the growing public health threats of emerging zoonotic infections and challenges in…
A: Zoonoses are diseases and infections that are naturally transmitted between humans and vertebrate…
Q: true/ false: When proteins are denatured 1°, 2°, 3°, and 4° structure is lost.
A: Denaturation is a process in which proteins lose their original structure or confirmation. The loss…
Q: Make 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer. DNA: 400 uL Sodium…
A: Dilution is the process of lowering the concentration of a solution by adding more of solvent to it.…
Q: What percentage of molecules of peptide GGGG has no ionized groups (e.g. has BOTH protonated…
A: Amino acids: An amino acid can function as both an acid and a base because of its structural…
Q: The inhibitor X prevents coenzyme Q (Q) from participating in electron transfer in the electron…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: 3. Researchers purified a new enzyme and during an initial characterization determined the Vmax to…
A: Enzyme inhibition is when an inhibitor bind to the enzyme at the active site or another site, which…
Q: Consider a protein with two surface-exposed histidine residues: HisA is a “typical” histidine…
A: The Henderson-Hasselbalch Equation for the deprotonation of a species is given below. pH= pKa +…
Q: You are studying the DNA binding protein CLAMP and you want to determine its binding affinity for…
A: Introducion Transcription is a process by which mRNA is produced from DNA and protein is produced…
Q: What is the total number of moles of ATP generated per mole of glucose in the glycolytic pathway and…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: could the answer be no cooperativity as well?
A: Cooperative binding is a phenomenon where the binding of one molecule increases the affinity of the…
Q: Glycogenesis occurs in both muscle and liver. Select one: O True O False Glycogen is released from…
A: Glycogen is storage-type homopolysaccharide that contain two types of glucose polymers: amylose:…
Q: 4. Peculiarities of hormonal regulation of glycogen metabolism in muscles and liver.
A: The glycogen synthesis mainly occurs in the muscle, and liver, using glucose-6-phosphate. The…
Q: Tay-Sachs disease is result from a)malfunction of cerebroside metabolism b)the accumulation of GM2…
A: Tay Sachs disease is a recessively inherited genetic disease. It is characterised by the destruction…
Q: 1. Describe five major types of lipids.
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: When a product inhibits an enzyme by binding to the active site, which of the following would occur?…
A: Introduction Enzymes are known as biocatalyst. They increases rate of a chemical reaction by…
Q: DETAILS 09 Select all of the following half reactions that require energy (work) to proceed as…
A: The reactions that require energy to proceed are called endergonic reactions. The half reactions are…
Q: ОН ОН ОН tautomerization
A: Tautomerization is the process by which structural isomers interconvert between each other. The…
Q: We eat foods containing sucrose (table sugar), lactose (milk sugar), and cellobiose (disaccharide of…
A: Carbohydrates that are obtained through the diet include monosaccharides, disaccharides, and…
Q: Kinetic Parameters of Enzyme-Catalyzed Reactions TABLE 12-1 The Values of KM, Keat, and Keat/KM for…
A: For a one-substrate enzyme catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Q11.3: What explains the observation that FADH2 oxidation yields one less ATP than NADH oxidation by…
A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…
Q: Explain why the combined presence of polyphenol oxidase and iron greatly increase the instability of…
A: Introduction Fatty acid is one of the macromolecule present in our body. Fats and oils are composed…
Step by step
Solved in 2 steps
- What is the purpose of having a sex hormone binding protein within the blood stream? What is the purpose of having a specific receptor for estrogen within the cell? The estrogen receptor binding domain has many known mutations that effect estrogen binding and result in breast cancer. One particular mutation found at aspartic acid is changed to glycine in cancer patients. Draw a potential interaction with the side chain of this aspartic acid with estrogen (name and label it) and how a mutation to glycine could affect this ability to efficiently bind to estrogen. 6.Discuss the family of nuclear hormone receptors and explain how ligand binding to such a receptor can result in changes in gene expressionWhich of the following statements is FALSE? The mammalian glucocorticoid receptor Choose one of the answers below awaits the steroid hormone at the cell surface and is internalized into the cytoplasm upon glucocorticoid binding. is a hormone-dependent transcription factor. may act as an activator or repressor of transcription depending on the promoter it acts on. is sequestered in the cytoplasm by HSP90 as long as the glucocorticoid is absent. does not require phosphorylation by protein kinase A to bind DNA.
- Which G-protein-coupled family subtype is Prolactin? Prolactin (PRL) receptors are G-protein-coupled family subtype Gs or GqWhen glucose is low and CAMP is present, CAMP's role is to O Activate catabolite activator protein (CAP) Activate RNA Polymerase Activate the repressor Deactivate the repressor23 of 41 Which of the following proteins is NOT encoded by a proto-onoogene? O Myc O Ras O E-cadherin Src O EGF receptor
- G protein coupled receptors play an important role in signal transduction in many cells. Label the four essential components of the G protein coupled receptor signaling system (blanks a-d in the picture) by choosing from the menus below. a b b Each answer will be used at most once, while some will not be used at all (select one for each): Group of answer choices transcription factor с transcription factor Show Transcribed Text d transcription factor B C. transcription factor G protein second messenger G protein second messenger IE G protein second messenger G protein second messenger receptor receptor receptor receptor enzyme enzyme enzyme enzyme steroid hormone steroid hormone steroid hormone steroid hormoneWhat is the structural difference between normal EGFR and oncogenic receptor, e.g. ERbB? How does it affect its activity?The figure below shows how normal signaling works with a Ras protein acting downstream of a receptor tyrosine kinase. CYTOSOL active receptor tyrosine kinase Taratas THERI signal molecule 00 active signaling Q Search active Ras protein GTP 99+ Į SIGNALING Il app.honorlock.com is sharing your screen. ✡ active signaling protein Y a
- Which of the following statements is FALSE? The mammalian glucocorticoid receptor: awaits the steroid hormone at the cell surface and is internalized into the cytoplasm upon glucocorticoid binding. is a hormone-dependent transcription factor. may act as an activator or repressor of transcription depending on the promoter it acts on. is sequestered in the cytoplasm by HSP90 as long as the glucocorticoid is absent. does not require phosphorylation by protein kinase A to bind DNA.The melatonin receptor exists in different isoforms: MT1, encoded by MT-1 gene and MT2, encoded by MT-2 gene. The following is the sequence corresponding to 90-140 base pairs (bp) of MT-1 and MT-2 genes. Which of the following statements are true for these DNA sequences. Select all that apply. 90 140 MT-1: 5'------GATATGCCCCCCCCGGCGCGCGATATGCCCCCCCCGGCGCGCGTGCGTGA -3' 3'------CTATACGGGGGGGGCCGCGCGCTATACGGGGGGGGCCGCGCGCACGCACT- -5' 90 140 ---GATATGATATATATATATATAGATATGAAAAATTTTTATATAGTGCGTGA- MT-2: 5' ---3' 3'-----CTATACTATATATATATATATCTATACTTTTTAAAAAATTATCACGCACT-- ----5' MT-2 will denature at a higher temperature than MT-1 1 MT-2 will denature at a lower temperature than MT-1 MT-1 will denature at a higher temperature than MT-2 MT-1 will denature at a lower temperature than MT-2Figure 9.8 HER2 is a receptor tyrosine kinase. In 30 percent of human breast cancers, HER2 is permanently activated, resulting in unregulated cell division. Lapatinib, a drug used to treat breast cancer, inhibits HER2 receptor tyrosine kinase autophosphorylation (the process by which the receptor adds phosphates onto itself), thus reducing tumor growth by 50 percent. Besides autophosphorylation, which of the following steps would be inhibited by Lapatinib? Signaling molecule binding, dimerization, and the downstream cellular response. Dimerization, and the downstream cellular response. The downstream cellular response. Phosphatase activity, dimerization, and the downsteam cellular response.
