Q: Contemporary evolutionary theory suggests that all living are linked together in a Great Chain of Be...
A: Alteration in hereditary traits of a particular species can be described as evolution. The term evol...
Q: Please answer fast Compare and contrast the three main types of exploit-ative species interactions...
A: Introduction :- There are a variety of species interactions. Some interactions are direct, such as l...
Q: 1. What temperature is maintained in a bacterial incubator? 2. What containers are used to culture ...
A: 1. The temperature which is maintained in a bacterial incubator is around 37 degree celcius. 2. Vari...
Q: In tertiary protein structure, the side chains of two cysteine residues are sometimes linked to each...
A: There's one special type of covalent bond that can contribute to tertiary structure: the disulfide b...
Q: riefly explain what convergent evolution is.
A: The change in heritable traits of biological populations over successive generations is known as the...
Q: Please answer fast Traditional Ecological Knowledge is an important topic in Ethnobotany due to its...
A: Introduction :- Traditional Ecological Knowledge (TEK), often known as Indigenous Knowledge or Nativ...
Q: What are the corresponding ring colors of the objective lenses of the microscope
A: Microscope manufacturing has made colour coding for the objective lenses in order to help in rapid i...
Q: Define the following terms: (a) papilla (b) abscission layer. How are each of thse structures invol...
A: Papilla These are complex structure that are formed between the plasma membrane and the inside of t...
Q: An electromagnetic flowmeter can measure the speed of blood flow through an artery during surgery. W...
A: Electro Magnetic Flowmeter -- The electromagnetic flowmeter are devices by which the voltage signal...
Q: In translation, the information in a mRNA transcript is used to build a polypeptide chain (protein)....
A: Translation the cellular process of formation of a polypeptide chain from the amino acids coded by t...
Q: QUESTION 7 A nucleotide of a DNA molecule consists of a ribose sugar, phosphoric acid, and a nitroge...
A: Introduction:- DNA is the molecular name for the molecule in all living things that conveys genetic ...
Q: The actions of cardiac glycoside drugs are not confined exclusively to heart tissue. How would inges...
A: According to our guideline we are allowed to do one question or upto three subpart of a question. P...
Q: Which one is a purine? OT
A: The nucleotide polymers that are responsible for determining and regulating the genetic characterist...
Q: Where are steroid hormones produced in the cell? O In the smooth ER O In the nucleus O In the rough ...
A: Steroids hormones: steroid hormones are following five groups: glucocorticoids, mineralocorticoids, ...
Q: perform an experiment to determine the complete melting profile of a relatively long DNA duplex with...
A: Melting temperature is the temperature at which half of the double stranded DNA gets melted out whic...
Q: Define mutations and explain their causes and categories.
A: The genome is made up of one to several long DNA molecules, and mutations can occur on these molecul...
Q: 1a-Farmers often use pesticides to kill insects to protect their crops. However, insect populations ...
A: Pesticides can easily debase soil, water, turf, and other vegetation. As well as killing pests or we...
Q: 5. The A DNA used for digestion was provided at a concentration of 2ug/ul. How much DNA (in microgra...
A: DNA Should be free of contaminants such as phenol, chloroform, alcohol, EDTA, detergents or excessiv...
Q: Make a pedigree chart based on the situation Blood Type • Blood type is determined by the presence ...
A: A pedigree chart is a graphic that depicts the prevalence and appearance of phenotypes of a certain ...
Q: Beyond the Biological sciences, can other disciplines utilize the methods of phylogenetic systematic...
A: The biological sciences are a zenith of fascination and curiosity to the researchers. This is attrib...
Q: Examine the 5 -3' sequence of bases of the DNA molecules (A D) shown below. I am only showing you th...
A: For option A, AAAT the complementary strand is TTTA. In this A pairs with T by two hydrogen bonds an...
Q: Q2) Give the major difference between: 1- Eukaryotes and Prokaryotes
A: Cells that do not have a nucleus are known as prokaryotic cells. The nucleus is found in eukaryotic ...
Q: Explain the difference between simple and facilitated diffusion.
A: Simple diffusion and facilitated diffusion are the same in which transport of substances occurs thro...
Q: How are saturated and unsaturated fat different ?
A: LIPIDS Fat and its derivatives are combinaly known as lipid. Compounds of C, H, O and the ratio of...
Q: thanol has been carried over into your DNA sample (two answers possible here, select both of them) a...
A: DNA is not soluble in ethanol . But when ethanol is there DNA gets separated by forming white precip...
Q: This photograph was taken in 1989, 9 years after Mount Saint Helens erupted. Compare this photo with...
A:
Q: Which connective tissue cell is a tissue macrophage? a.Mast cell b.Plasma cell c.Fibroblast d.Myofi...
A: Muscle fibers are a type of cell that may be found all throughout the body. The basic function of th...
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA...
Q: Genosensors are biosensors based on the principle of complementarity and hybridization of DNA strand...
A: Biosensors and genosensor continue to offer solutions and control of various processes across a rang...
Q: Briefly describe two different environmental scenarios that influenced the spread of the dominant al...
A: The first environmental scenarios that the principal study includes a correlation of the resistance ...
Q: Poliovirus contains a protein that possesses an NLS.
A: Viruses are intracellular parasites that rely on host cells for completion of their life cycles...
Q: Differentiate the intermandibular joint of the horse, ox, sheep, goat and pig.
A: Intermandibular joints are joints specifically associated with biting herbivory and present between ...
Q: What codons ar e found in the mRNA for the two mutated DNA?
A: Answer 1: - There are 14 codons in the original DNA sequence. Answer 2:- Similarly, there are 14 cod...
Q: Take a sequence from NCBI of pathogen And Make vaccine of it. From vaccine predict tool iterpretatio...
A: Before an vaccine is at any point suggested for use, it's tried in labs. This cycle can require quit...
Q: Your grandmother has severe osteoporosis, you advise her to do these things for her dietary calcium ...
A: Osteoporosis is a type of bond is order in which density and strength of bone get reduced. Eat liter...
Q: 1. What is N-glycan microheterogeneity?
A: In eukaryotes, N glycosylation is one of the most essential post-translational modifications. Some p...
Q: In humans, the diploid chromosome number is 46 (2N = 46). For each of the meiotic stages listed belo...
A: In humans, the meiosis occurs in 2 stages. Meiosis 1 & 2. Both have 4 stages. 1. Prophase I (Le...
Q: How does a person get antibodies upon vaccination?
A: Vaccines are well define to state that they are been refer to as the non-pathogenic proteins that m...
Q: Explain your answer and cite references in APA format. 1. What does mashing do to the fruit? 2. Why ...
A: Introduction DNA extraction is a technique for isolating DNA from cell membranes, proteins, and othe...
Q: What codons are found in the mRNA for the two mutated DNA
A: 1. The cell reads the sequence of the gene in groups of three bases. There are 64 different codons:...
Q: Draw digestive system
A: Introduction The gastrointestinal tract, as well as the digestive accessory organs, make up the hum...
Q: The following flatworm genera are monoecious, EXCEPT… … Fasciola. … Dugesia. … Schistosoma. … Tae...
A: A monoecious organism (plant or invertebrate animal) is one that has both the male and female reprod...
Q: Q3) A- Explain of the following: 1- Cytokinesis 2- Bacteriophages 3- MTOCS 4- protein turnover
A: 1)Cytokines:- Cytokines are tiny proteins that play an important role in regulating the growth and a...
Q: How does your Mycobacterium tuberculosis pathogen obtain the requirements to build its biological ma...
A: According to Lipidomic experiments, it was revealed that methyl-branched lipid carbon sources from t...
Q: Explain why oil does not dissolve in water ?
A: Introduction Water is a gaseous, liquid, or solid material that is made up of the chemical elements...
Q: Which of the following does NOT ALWAYS describe ecdysozoans? a. They exhibit bilateral symmetry. ...
A: what is ecdysozoans? The Ecdysozoa is the moment major clade inside the Bilateria , and it incorpora...
Q: What do pathogenesis related proteins and phytoalexins have in common? How do they differ? 5. Des...
A: Pathogenesis Related proteins(PR proteins )are the proteins produced in response to a pathogen .Thes...
Q: Describe the roles of ATP in the sliding filament mechanism of skeletal muscle contraction. (b)...
A: Sliding past theory explains the process of various muscle proteins such as actin and myosin sliding...
Q: How might early dog domestication compare with pet dog breeding in the U.S. today? Explain in detail...
A: Early dog domestication- It's found that the earliest dogs in US were not domesticated from local wo...
Q: The kidneys are surrounded by a protective capsule which is composed of
A: The pair of bean-shaped organs located in the abdominal cavity, that are responsible for production ...
(Plant Pathology) Is one type of culture medium capable of being used for all types of pathogen? Why or why not?
Step by step
Solved in 2 steps with 1 images
- (1) why can't we say "sterile" technique (2) how are aseptic technique similar and different in the lab and Healthcare field?Be specific and explain at least 2 differences and two similarities. (3) You are asked to develop a method of transfer an unknown organism from a liquid broth to a solid petri dish.list each step that you would have to take .be specificWhy is it important to limit the quantity of cells used to prepare a smear? Mark all that apply: O So that cells are not clumped and don't entrap stain creating erroneus results So that no contaminants are introduced onto the slide by being entrapped in clumps OSo that the cells are spread out enough that cell morphology can be discerned OSo that the cells are spread out enough that the arrangement can be observed O So that there are small groups of cells clumped together to make them visible Microsoft Bing 11:31 AM 87°F Sunny 9/14/2021What is the importance of employing aseptic techniques? Give an example of a situation in the laboratory that might happen when this method is not practiced.
- What is the purpose of fixing a smear? Mark all that apply: 1. To attach the bacteria to the slide 2. To cause the cells to shrink and become distorted 3. To kill the bacteria so they aren't harmed by the staining method 4. To break down the cell wall in order to make the cells accept stain 5. To kill the bacteria to make the slide safer to handleWhy is it important to limit the quantity of cells used to prepare a smear? Mark all that apply: 1. So that cells are not clumped and don't entrap stain creating erroneous results 2. So that the cells are spread out enough that cell morphology can be discerned 3. So that there are small groups of cells clumped together to make them visible 4. So that no contaminants are introduced onto the slide by being entrapped in clumps 5. So that the cells are spread out enough that the arrangement can be observedDescribe the process to make a 4-phase streak plate beginning with your first streak (i.e you have bacterial culture on your sterile loop and are about to start to streak your agar plate ).
- What things can be done during sample collection of a sick patient to help eliminate the culture of normal flora?There are so many microbes in a single mL of culture, it is very difficult to perform one dilution to produce countable cells. Microbiologists need to perform a dilution series, where multiple dilutions are performed in sequence to arrive at the correct dilution. Dilutions are cumulative. Multiple the series of dilutions together to find the final dilution value. If 3 serial dilutions are performed, each with a value of 0.01, what is the cumulative dilution? Express your answer as an exponent, e.g. 0.1 would be 1e-1 and 0.01 would be 1e-2What are the basic differences between the three plating methods? Fill up the following table. Streak Pour Spread Equipment/ Materials used in immobilizing and separating cells Purpose(s) (isolation, enumeration, both) Type of colonies (surface, subsurface, both) Advantage Disadvantage
- What is the purpose of this subculture procedure? In general, how is this carried out in tissue culture maintenance?What are the advantages and disadvantages of using the Wet Mount technique? What are the advantages and disadvantages of using the Hanging drop technique? What are the advantages and disadvantages of using the Slide Culture technique? pls elaborate each, thank youSelect all that apply to a negative stain: 1. involves a washing step 2. cells may be distorted or shrunken 3. uses an acidic or negatively charged dye which stains the background 4. uses multiple dyes in the procedure 5. uses only 1 dye in the procedure 6. involves fixing 7. does not involve fixing 8. cells will not be distorted or shrunken 9. does not involve a washing step 10. can show cell morphology, size, and arrangement 11. uses a basic or positively charged dye which stains the bacterial cells