M Inbox (53,887) Answered: 4. F C Search Textbo PLnwx-GvHgLnU/edit# prmal text Arial 12 + B. 9. nies cyanobacteria will appear (without a microscope) as very seen in this video). Observe the following images of r 100x and 400x magnification with a light microscope: eaese gnification Anabaena sp. 400x magnification a grow as two different types of cells: those that are dioxide to make sugars), and heterocysts (that fix nitrogen ids). Although these cells are genetically identical, each is ferences in gene expression, a key concept in biology you r. In the 400x magnification image, you should be able to of cells making up a colony of cyanobacteria. different types of cells you can see in this image:
Q: Possible Unknown Strains: Stapylococcus epidermidis, Bacillus subtilis, Staphylococcus aureus,…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: express some basic evolutionary relationships among groups of microorganisms
A: Microorganisms, often known as microbes, are tiny organisms that can be unicellular, multicellular,…
Q: lease explain college Microbiology for m
A: Science is a vast subject that consists of various dimensions based on the area of study. It is the…
Q: 1. Which of the following microorganism is a non-cellular organism? b. Fungi a. Virus c. Bacteria d.…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 1 Death is a major event not only for the person who dies but also for the microbes that inhabit…
A: Microbes are abundant in our surroundings in various domains. Also, the microbial diversity is very…
Q: You come across a gram positive bacterium with the following nucleotides: ATTCGATCGGTATAT. This…
A: Nucleotides are the monomeric units that make up the nucleic acids like DNA (deoxyribonucleic acid)…
Q: Detail in pictures
A: An endospore is a non reproductive, tough and dormant structure produced by some bacteria. It is…
Q: Based on this video: https://youtu.be/3PYdMaClUmw Observation Interpretation Test Tube…
A: Chemical reactions in living cells are catalyzed by enzymes.
Q: Explain why the sequences of these two genes are similar to each other but not identical.
A: Genes are the functional unit of heredity. The genes code for proteins which are vital for growth…
Q: Is it the statement True or false? Please kindly elaborate the answer because i got confuse in this…
A: Symbiotic relationship is a close ecological relationship between the individuals of two (or more)…
Q: Please write, in paragraph form, how you would identify the organism step by step. Remember to…
A: Proteus vulgaris found in people and animals' intestines are Gram-negative, rod-shaped,…
Q: + Bio Questions - Google Sheets b Biology Question | bartleby b My Questions | bartleby + Smartwings…
A: Bacteria are unicellular, prokaryotic organisms which are devoid of membrane bound organelles and…
Q: Question: Give at least 5 Genus and Species under G(+) cocci and G(+) bacilli
A: Solution : Gram-positive cocci include Staphylococcus (catalase-positive), which grows clusters, and…
Q: A cell is 25 μm wide when viewed at 1,000× magnification. Thismeasurement can also be written…
A: 1,000× magnification means that to the naked eye, the image would appear 1000 times larger than it…
Q: If your instructor gave you a culture containing one species of a microorganism, how would you be…
A: According to R H Whittaker five kingdom classification, organisms are grouped into Monera, Protista,…
Q: Write the process/steps in Preparation of Bacillus atrophaeus culture using Blood agar plates and…
A: Introduction : Blood Agar (BA) is an enhanced medium used to culture bacteria and microorganisms…
Q: Answer each of the questions below using the plate images provided. Nutrient Agar 1 EMB Blood Agar…
A: EMB stands for Eosin Methylene Blue. EMB is a stain that is selective for gram-negative bacteria.…
Q: 5. What is the definition of hydrolosis reaction?
A: The metabolism essential for life is simply a set of chemical interactions between biomolecules. A…
Q: Answer all of the following true/false questions: Please use A (True) and B (False) for your…
A: Microbiology is the study of minute or micro organisms that cannot be seen through naked eyes. These…
Q: Complete the table: Bacterium Shape of cell Arrangement of cells Other important cell feature…
A: All the above mentioned organisms are bacteria.
Q: d-6f06-490d-b3d3-cb18767c100 Post-Lab: Streak Plate Isolation Homework. Due in 12 hours 2/5 answered…
A: Colonies of bacteria are formed on agar plates, basically a solid growth medium with added…
Q: (a) You received three cultures (Escherichia coli, Saccharomyces cereviciae, and Rhizopus oryzae)…
A: PCR is used to amplify a target DNA.When boiling method and Gene releaser were used then the…
Q: All types or kinds of media powder has a standard ratio of 23:1000. Meaning that 1000 ml of water is…
A: We are allowed to do upto 1 questions or 3 sub part of a question. So please re-upload to undone…
Q: You perform the Methyl-Red(MR)& Voges-Proskauer(VP) test and gather the following results:…
A: MR-VP Broth is recommended for use in the performance of the Voges-Proskauer and Methyl Red tests as…
Q: Below are photos of 3 bacteria, letter lableled, inoculated onto MSA plates and incubated. Note no…
A: Microbiology is the study of microscopic organisms that are mostly not visible to the naked eye.…
Q: QUESTION 4 Select all the correct statements for the Streak Quadrant Plate methe O This method…
A: Quadrant speak plate method involves four individual streaks. The method is used for the isolation…
Q: Describe Hybridoma technique .
A: Hybridoma is a technique to produce monoclonal antibodies in the clinical laboratory . Monoclonal…
Q: Purpose Solve the identity of an unknown bacterial specimen by creating a dichotomous key and using…
A: A dichotomous key is an identification tool used to differentiate organisms based on their…
Q: Please draw a dichotomous key using these tests to isolate each bacteria strain. Start with Gram…
A: * A dichotomous key is used to find out the different individuals based on their observable traits.…
Q: A student is asked to identify which pathogen is causing a patient infection. The student conducts a…
A: Acid-fast bacteria are gram-positive bacilli that are generally rod in shape. In addition to the…
Q: Do you know the differences and how chemical agents are utilized as per the CDC? That is the…
A: The hospital can be kept germ free by : Preventing the spread of germs from unsafe surface. Insist…
Q: These are all Gram stains. Which one shows Gram positive bacilli2 OA OB
A: Gram staining is widely used for division of bacteria into two classes One that take up the gram…
Q: Procedure A Add ul ampicillin to 50 of Take mixture analyse OD600 Top up to 50ml. to Add fresh LB…
A: This graph is of two groups group A and group B. group A is about ampicillin and group B is about…
Q: Microorganisms are pathogenic organisms with diameter of 0.5 mm or less. Select one: O True O False
A: Microorganisms are prokaryotic unicellular organisms which are present in great diversity on the…
Q: Shown below is a micrograph of numerous specimens. The magnification is 55X. Based on this,…
A: Introduction The cell is life's most fundamental structural and functional unit. Every cell has a…
Q: (The color i see on my screen is purple.) genera (not species) of bacteria that are consistent with…
A: Bacteria having thick cell walls are generally known as Gram-positive bacteria. These organisms show…
Q: With regard to studying the mechanism of conjugation,what is the purpose of using a U-tube?
A: Plasmids are the two circular chromosomes of bacteria that are exchanged during the conjugation…
Q: The following bacteria are Select one: a. Streptococcus b. Diplococcus O c. Diplobacillus O d.…
A: Given: An image of stained bacteria iis given, have to name the bacteria.
Q: Give at least 5 Genus and Species under G(+) cocci
A: Gram positive cocci- Staphylococcus aureus. Micrococcus luteus . Staphylococcus saprophyticus…
Q: Salmonella typhi Cyanobacteria Jame of Anabaena spiroides nicroorganism Genus species) Morphology…
A: Salmonella Typhi (S. Typhi) are bacteria that infect the intestinal tract and the blood. they are…
Q: 9. Explain about flagella?
A: Introduction :- Flagella are tiny, hair-like structures that aid in a cell's movement.
Q: We did the experiment in class but I don't understand the second page which is number 5 can these be…
A: Gram-staining is a method to classify bacteria into two groups; Gram-negative and Gram-positive. The…
Q: Choices: Gram stain Simple stain Ziehl-neelsen method Schaeffer- Fulton method Negative stain None…
A:
Q: 4X 4X SPECIMEN 10X 10X 40X 40X 100x 100X COARSA NOUU FHE FOGR MAGNIFICATIO N USED IN THE VIRTUAL…
A: Total magnification = objective magnification × ocular magnification Therefore, total magnification…
Q: Summarize the video. https://youtu.be/GM0by2axiLM
A: Test Cross -- Definition --A genetic cross between a homozygous recessive individual and a…
Q: Write the process/steps in Preparation of Bacillus atrophaeus culture using Blood agar plates and…
A: BLOOD AGAR It is enriched medium which is used in culturing of microbes or bacteria that do not grow…
Q: 8. Explain about Microbial taxonomy?
A: Microorganisms can be categorised through the use of microbial taxonomy. Organisms that fit into the…
Q: in Asignacion x What is the xE Untitled do x 234610#question-179879-49 Q O * * a O Dasaoo eO…
A: Antibiotics treat bacterial infections. Fungi cause infections like athlete's foot, yeast…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- EcoRI 4359 Aatll - Zral 4284 Bei 4209 BsrBl 4205 Clal - BspDI 23 Hindill 29 EcoRV 185 Bmtl - Nhel 229 Sspl 4168 Earl 4155 Acul 4048 Xmnl 3961 Hincll 3905 Scal 3844 BamH 375 Sgrl 409 Banll 471 Banll 485 Вы 3787 Bsl 3759 Bgl 528 Sphl 562 EcoNI 622 Sal - Acct - Hincll 651 Pvul 3733 Pstl 3607 Bartl 3602 Pshl 712 Asel 3537 Eagl 909 Bell 949 Bsal 3433 BarDI 3420 Nrul 972 PBR322 4,361 bp BstAPI 1045 Ahdi 3361 BspMI - Bfual 1063 PAMI 1315 Bsml 1353 PAMI 1364 Acul 3000 Ori Styl 1369 Aval - BsoBl 1425 PpuMI 1438 Msel 1444 Bigl 1447 Ppu 1480 AlwNI 2884 Bell 2777 kI 2682 rop Drdi 2575 Bsgl 1650 BspEI 1664 Pcil - Afl 2473 rBl 2404 Earl 2351 Bspol - Sapl 2350 Ndel 2295 BstAPI 2291 Bsaß 1668 Xmat 2029 Pvull 2064 BsmBI 2122 Dndl 2162 BstZ171 - Acct 2244 Bsal 2225 TthI- PI 2217 Figure 1 If your gene of interest was inserted at the Sphl restriction site of the plasmid illustrated in Figure 1, describe the screening process to select the positive recombinants.blackboardcdn.com/5bfc08ba3fldc/14683296?X-Blackboard-Expiration=16245468000008X-Blackboard- 19 / 47 100% 1.4. Functions of the light mlcroscope parts Complete the following table by writing the function(s) of each of the parts indicated. Structure Function Diaphragm / iris Stage opehing Lamp Objective lenses Eye piece Coarse and find adjustment knobs Stage Stage rack prt sc delete home backspace lock enter pause t shiftod 1 Meet- zpn-oxtp-bxu Unit 2 test - cells, organelles, mer X G In order to deteminie how cells rx A testing.illuminateed.com/assessment/5f765e7b4c2b2eb5078b7842/5f765e7b4c2b2eb5078b7843/1?rldbqn=1 ail YouTube Maps O News (1) Facebook Launch Meeting - Z... TikTok sues U.S. go... i! Spanish Present Pro... embrane, transport fall 2020 D. Water moves into and out of the cell at the same rate since the cell is isotonic to its environment. 7. In carrying out normal activities, cells use oxygen and produce carbon dioxide. The concentration of oxygen is higher in the blood than inside the cell, so oxygen moves into the cell. Similarly, carbon dioxide moves out of the cell into the blood because the concentration of carbon dioxide inside the cell is greater than the concentration outside the cell. How do the small molecules of oxygen and carbon dioxide move through the cell membrane?
- t/Root/Pages/TestTaker/MonitorLaunch.aspx?id%3DE9B80AE3-962E-4628-B79D-A3F06F1CAB72 MonitorLaunchaspx?id%3DE9B80AE3-962E-4628-879D-A3F0EFICABT2-Google Chrone uninoculated tube The medium shown here was inoculated with a bacterium then incubated for 48 hours; an uninoculated control tube is also present for comparison. This particular bacterium gave a for this test. a) O negative result b) O positive result c) O indeterminate result Review Later d) O variable resulthttps://youtu.be/w7aIxiZQ60g Multiplexing agglutination https://youtu.be/uWStmyJ5Qc0 This is the multiplexing agglutination. Lab report I don’t really know what to talk about, the data, conclusions and the purpose of this. Need help pleased-6f06-490d-b3d3-cb18767c100 Post-Lab: Streak Plate Isolation Homework. Due in 12 hours 2/5 answered Unanswered Post-Lab: PIV 2.5 Homework Unanswered How do colonies of E. coli differ from those of P. mirabilis? inancwarnd
- les/test/tq.php?testid=2804&strandid%3D&element%3D&difficulty=assessment&assignment_id%3D45196931&load_test%-D1&teacherPr B Brainly.com-For st.. O Instagram N Netflix a Escape Room (Und. USATestprep, LLC - E Google Docs Stu wrerhd.cells at rer rote due to the siiple diffsion of Save C) 01ann suan an sianua LUPInaPLiaipaih ep snan aun aAPa IM JaPAA active transport. Glucose molecules will move from the cells into the solution in the beaker D) through facilitated diffusion. When examining the major macromolecules in the cell, a student isolates two molecule types that are directly responsible for cellular energy. A comparison of which molecule types will be most likely to include the molecules primarily responsible for cellular energy? A) proteins and lipids B) carbohydrates and lipids proteins and carbohydrates D) carbohydrates and nucleic acids Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a…1:07 < Вack Untitled 6 Brownian movement of bacteria: O a. Can be observed by the of soft agar technique O b. Can be observed by staining of Staphylococcus aureus Oc. Is common in Escherichia coli or Proteus vulgaris O d. Is common in Staphylococcus aureus O e. Can be observed at the edge of a microscope CLEAR MY CHOICESATestprep, LLC- Online State es/test/tq.php?testid-9848strandid=4936&element=D&assignment id-41828865&load test=18teacherPreview=#test A cellular protesses, maximiZing cIcIency. The ENDOSYMBIOTIC THEORY 3nascond edybee pel, he eady nukarycte ponsuned otosuhetc ngs n the plas membrane t nn ses pokaryote ge me to endonmbe comporen Incluting anuceus ns endpl um baderis roued int Endplaun cke Nudes Phot etic baceriam Modern photosynthetic ukaryote Proto-ukaryote -Meochondrim Atec bacenum Anetredon even te ancesia kaye conumed ae bic bactia fat evoived eto mnodhonca Modern heteotrophic eukanyote The diagram provided shows the evolution of membrane-bond organelles in eukaryotic cells. The Endosymbiotic Theory proposes that the organelles distinguishing eukaryote cells evolved through symbiosis of individual single-celled prokaryotes. Which of these statements provides supporting evidence for the endosymbiotic theory? A) Chloroplasts have a single phospholipid membrane. B) The DNA in…
- BONUS (15 points) The fallowing series of dilution was prepared from a specimen to determine the number of bacteria. There were 62 colonies on the agar plate prepared by transferring 0.3 ml from the tube number 4. Calculate the dilution factors for each tube. What is the cell concentration in the original specimen? Calculate the total number of cells in tube number 2. étv A) F12 F9 F10 F7 % & %3D delete 5 { T Y J KCell Determination can be reversed under certain circumstances. True False Reason for Answer ? O Source 皇 工 DIV B I U S x, x* Styles Font Size - A- A Format Words: 0, Characters (with HTML): 0/1000000 lFile guft 1.yt Machine Cochise14ee7 Lane 0 Pmer. DTarPOPD mob Comment 17703 Spacing 15.06 Siga C 17A 4 G 2 Bases 0 an 2004 Gelstat ime123 219 20 30 60 70 NNACTCA TCTOGTGGA TTC CTA TCCTG AC A AG TGATGTG CAAAC TG GTAACTC TG AG GCAGATAAC CA G GG CA AA AAGGTG TATAAG 100 110 140 100 CAGA AG TC CGGA AA A TCA TT TAA 170 TAAA ACA AAGCCCTAACT TG GAAG AAGT TCA GTTTTACACA TCT TTA TA TG GAGAGAA 180 TAT TCTAT TA ATOTCCTGT TA TATT TG TCA TATTCA TA CAGT TGTCACAGTATATT TCAAAC CA AC TG TTTAAAA ACAAAC TO AAATAAA 210 230 240 260 270 AAATTTAAATACCCT TA TG TA AA ATAG GCT TC CC TG GTG GCTCAG GG GTAAAAA ACTCGC CCGC CA ACGCAG GAGATGTAGAT TTGATC CCT 300 310 340 350 410 430 440 GG GT TAG GA AG icCCTa GAGA AGGAAATGAAAAAC CACTCTAG TAT TCT Tac CTG GG AAATC CCA TGGACAG AG GAGCOTO GAG G Gc 490 500 SI0 530 TACAGTCCATGGGAGTCGCAA A AGAGT TG GACATG ACTAA ACA ACAACATATAAAATAACCT TACTC CATAATGTCAAACT TATOTCACAC S40 AAA ATGCAA AGT TCT TACATCTAT TAACTTTTATGOT TAAATATA ACCTAATGCACTOTTT TATACAGCA ACAACTACT TT TT TATTT TAAA…