In which type of cross(es) can we apply and demonstrate the law of segregation and law of independent assortment? Why can’t we apply the 2 Mendelian laws on monohybrid crosses? Explain briefly
Q: The locations of numerous lacI - and lacIS mutations have beendetermined within the DNA sequence of ...
A: c. LacIs is a trans-dominant mutation that stops transcription in both operons. Only the genes cis t...
Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...
A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...
Q: explain this LAPTM5 restricts HIV-1 and Vpr counteracts the restriction
A: Lysosomal Protein Transmembrane 5 ( LAPTM-5) help in transportation of of HIV-1 envelope into lysos...
Q: For water to vaporize O energy must be supplied. both energy must be supplied and hydrogen bonds bro...
A: Introduction: The process through which a liquid state changes into a vapour state is known as vapor...
Q: Name three important functions of DNA.
A: DNA is deoxyribonucleic acid which acts as genetic material in all organisms present on Earth. DNA i...
Q: What happens if the body's cellular respiration system malfunctions? Explain your answer
A: Malfunction is defined as something stops working. Cellular respiration is process which occurs to b...
Q: Question: What are the key concepts of global health?
A: Global health It is concerned with medical and health concerns that have a worldwide influence. It a...
Q: Swimmers may not pay attention to hydration as compared to runners. Swimmers do not get dehydrated. ...
A: Given: Swimming is tough exercise during which your body sweats in the water. It is like if you were...
Q: What is the justification for considering gap junctions and plasmodesmata to be functionally similar...
A: Introduction: Plasmodesmata are living cytoplasmic connections between neighboring plant cells which...
Q: What cellular structures of onion are more easily seen in stained as compared to unstained preparati...
A: After staining with potassium iodide, the following structures can be observed by a compound microsc...
Q: Which group has evolved a respiratory system where air flows one way through the lungs? O lung fish ...
A: The group that has evolved a respiratory system where air flows one way through the lungs:- Option...
Q: Discuss the possibility that tundra species could dodge the climate change bullet simply by adapting...
A: The tundra biome is characterised by its chilly and icy landscape. This biome has a brief growing se...
Q: 8:25 Screenshot_2021120 What I Can Do Activity 6. What is your stand? Directions. Below are some of ...
A: A genetically modified organism (GMO) is any organism whose genetic material has been altered using ...
Q: 4. Comparative Morphology Data. Using your text and prior knowledge, determine the morphological cha...
A: Characteristics table attached below If character is present mark in "+", and if absent mark in '--'...
Q: Explain The Discovery of CRISPR ?
A: The common technology that can be used to edit genes is refers as the CRISPR. In other words you c...
Q: If a cell grows on a minimal media and it is made up of phosphate as a source of carbon and energy, ...
A:
Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the a...
A: Protein is the final product of a gene that determine the phenotype of the organism. Protein synthes...
Q: Make simple diagrams tracing the life history of Schistosoma japonicum
A: Schistosoma japonicum: Schistosoma japonicum is a significant parasite and one of the main schistos...
Q: Bombay effect.
A: Bombay effect The Bombay blood group, is a rare blood type. This blood phenotype was first discovere...
Q: During DNA replication, each new strand of DNA is synthesized from both ends at once. This statement...
A: DNA Is the basic unit of inheritance. DNA undergoes replication, transcription, translation, etc for...
Q: Rabbits may be classified as agouti, chinchilla, Himalayan, or albino according to coat color. A cro...
A: Rabbits may be classified as agouti, chinchilla, Himalayan, or albino according to coat color We kn...
Q: You are testing the effect of a particular fertilizer on a plant's growth. Your control plants don't...
A: Hypothesis It's an assumption, that's put up for the purpose of argument and then examined to determ...
Q: Which is false about respiratory systems??  a. Usually the higher the metabolism, the more efficien...
A: The respiratory system is essentially a biological system in animals as well as plants that consists...
Q: Describe the structure of viruses/ how they replicate. Include how the genome of the virus could aff...
A: I am giving answer to the first question only. Please repost the remaining question separately. Vir...
Q: Identify features that are present in eukaryotic cells but not in prokaryotic cells. Select all that...
A: Identify features that are present in eukaryotic cells but not in prokaryotic cells. Select all that...
Q: If you fall into a moving water, aiming to float is important. Use your arms to back paddle to slow ...
A: Arm paddles are light weight tools great for improving and tweaking techniques. Paddles increase wa...
Q: 2 3 4 5 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 ху In human, each cell has how many chromosomes...
A: The cell division is the process that involves breakdown of the mother cell and produce two or more ...
Q: Explain why enzymes are considered "biological catalysts".
A: * All enzymes are proteins but all proteins are not enzymes. *An enzyme will increase the chemical r...
Q: Cite and explain the factors that led to an enormous bloom of animal diversity in the Paleozoic era.
A: Paleozoic era began somewhere around 541 million years ago and ended around 252 million years. The ...
Q: 1. In Figure 10, can you observe the unevenly thin stretch along the walls? If yes, identify these s...
A: Plant cells have fixed regular shape. This is because they have a cell wall made of cellulose that r...
Q: For a simulated population in AlleleA1 to be in Hardy-Weinberg equilibrium, the mutation rate would ...
A: The physical traits or appearance of an organism are referred to as its phenotype. The genotypes, or...
Q: On which sex is the mandible tip (or the chin) squarer? a. males b. females c. on both sexes d. ...
A: According to many studies researchers have found that Mandible tip (or the chin) squarer is the resu...
Q: A trait exhibits 100% concordance in both monozygotic and dizygotic twins. What conclusion can you d...
A: Answer- both genetic and environment factors are important
Q: At the metaphase plate during metaphase I of meiosis, there are Select one: A. Chromosomes consistin...
A: Meiosis is a reduction division .it is occured in germ cells of our body. During metaphase 1 of mei...
Q: Describe how a natural disaster can create an ecological disturbance, and how this can impact biodiv...
A: A geographic area where plants, animals, and other organisms, as well as abiotic factors work togeth...
Q: Describe what happens when a pigment that is part of a lightharvesting complex absorbs light.
A: Photosynthesis is the conversion of light energy into chemical energy by phototrophs, which is then ...
Q: In a population of geese, the narrow-sense heritability for wing span is shown to be 0.5. If the phe...
A: The formula that can be used to calculate narrow-sense heritability is equal to: h2=VAVP Here h2 eq...
Q: If at least one dominant allele at two different gene loci, A and B are required for normal hearing,...
A: Dominant genes are those genes whose phenotypes are expressed and recessive genes' phenotypes are su...
Q: Study the graphs shown in the picture. Describe the patterns observed in the top group depicting ch...
A: Biodiversity refers to the variety of life on earth at ecosystem, genetic and species levels.
Q: PART IV. MOLECULAR BIOLOGY (DNA/PROTEIN SEQUENCES) Scientists use DNA/protein sequences to figure ou...
A: Cytochrome C is a protein found in mitochondria which plays an important role in ATP synthesis. It i...
Q: Can someone please explain the distinction of natural selection and evolution of populations?
A: Answer
Q: Sexual reproduction introduces genetic variation more frequently than asexual reproduction. Which pr...
A: In Asexual reproduction only single parent is involved in producing offspring because of that offspr...
Q: When you flush your toilet, where does the wastewater go? Trace the actual flow of this water in you...
A: The wastewater treatment plant is an important part of the community. It helps ensure that the waste...
Q: What is the relationship between the population's surviving members and the environment? and what ro...
A: Population It is described as a group of individuals of the same species living in the same region. ...
Q: please help me do this question it's an essay question, it needs atleast 8 to 10 points
A: Host defenses are protective mechanisms against infections which consists of natural barriers such a...
Q: The following experiment was set up to understand how catechol oxidase converts catechol oxidase cat...
A: Catechol Pyrocatechol or 1,2-dihydroxybenzene are other names for it. It is the ortho isomer of the...
Q: Explain how coenzymes connect the light-dependent reactionswith the Calvin–Benson cycle
A: Photosynthesis is the conversion of light energy into chemical energy by phototrophs, which is then ...
Q: What is the number and types of lamprey species that are present in the Great lakes?
A: ANSWER;- 1. 5 number present in the Great lakes. Many people believe the obtrusive ocean lamprey is ...
Q: Please help explain this LAPTM5 Transport HIV-1 Env to the lysosome for degradation
A: Answer
Q: What is the life cycle of sea lampreys, and the various control methods for lampreys intersect with...
A: Lamprey or Petromyzon which is commonly known as jawless fish . Lamprey is parasitic in nature use t...
In which type of cross(es) can we apply and demonstrate the law of segregation and law of independent assortment? Why can’t we apply the 2 Mendelian laws on monohybrid crosses? Explain briefly
Step by step
Solved in 2 steps
- 1. The allele G for yellow stigma is completely dominant to green (g). Supposingtwo strains of autotetraploid plants are available and their genotypes are as follows:GGgg – in this plant the gene is close to the centromereGggg – in this plant the gene is far from the centromere If these two plants are crossed:a) provide the gametes that can be obtained from the two plants;b) provide the genotypic and phenotypic ratios of the offspring. 2. Consider the illustration below. Diagram the configuration you would observe at Anaphase I if crossing-over happens within the inversion. (IMAGE ATTACHED)1.What is the genotype of the F1 generation of the corn monohybrid cross described above? 2.What is the phenotype of the F1 generation of the corn monohybrid cross described above? 3.What are the possible maternal and paternal genotypes of the F1 gametes of the corn monohybrid cross described above?3)Mendel found that crossing wrinkle-seeded (rr) plants with homozygous round-seeded(RR) plants produced only round-seeded plants. What genotype ratio and phenotyperatio can be expected from a cross between a wrinkle-seeded plant and a heterozygousplant for this characteristic?
- 9. Please determine whether the allele responsible for the trait is dominant or recessive. (A) (B) 1 2 10.For a cross between a female color blind carrier and a male color blind person, what is the probability for the female offspring to be color blind? What is the probability for the male offspring to be color blind? Please explain. 11.Consider the genetic map shown below AD Which two alleles have the highest recombination frequency? Which two have the lowest recombination frequency? O Focus ! 72°F DELL F5 F6 PrtScr Insert Hor FZ F8 F9 F10 F11 F12 23 %24 3. 4. 8 E R T1.What are the possible genotypes of the parent gametes of the corn dihybrid cross described above? 2.What is the genotype of the F1 generation of the corn dihybrid cross described above? 3.What is the phenotype of the F1 generation of the corn dihybrid cross described above? 4.What are the possible maternal and paternal genotypes of the F1 gametes of the corn dihybrid cross described above?9. Make a pedigree for each of the following situations. For each individual, write the individual's genotype (when possible) next to the individual's symbol (e.g. O xty, I Gg): a. Two parents do not have cystic fibrosis and they have a daughter with cystic fibrosis and a son who does not have cystic fibrosis. The daughter grows up and she mates with a male who does not have cystic fibrosis. Their only child is a boy and he has cystic fibrosis. b. A man with hemophilia mates with a female without hemophilia. They have one son and one daughter. The daughter has hemophilia and the son does not have hemophilia. The son grows up, and he marries and mates with a female. Their only child is a boy, and he has hemophilia.
- 1.What are the phenotypes of the parents of the corn dihybrid cross described above? 2. What are the possible genotypes of the parent gametes of the corn dihybrid cross described above? 3.What is the phenotype of the F1 generation of the corn dihybrid cross described above?6. Using a Punnet square, please calculate the probability of having a Aabb offspring in a cross AaBb x aaBb 7. What is the probability of having a AAbbCcDd offspring in a cross AaBbCCdd x AabbCcDD? (Please show how you derive your answer) 8. In a cross between a blood type AB male and a heterozygous type B female, what are the possible genotype and phenotype for the offspring? What is the phenotypic ratio? :On D. Focus h. 72°F LL F4 PrtScr Insert Home F5 EZ F8 F9 F10 F11 F12 & 3. 6 7 8. 09. E R Y8. Consider the following hypothetical cross: Tall, + tendrils X Short, - tendrils F1: Tall, + tendrils F1’s are backcrossed to recessive parent. 850 progeny produced: Tall, + tendrils 221; Tall, - tendrils 195; short, + tendrils 190, short, - tendrils 194. Explain pattern of inheritance.
- 2. Determine the genotypes, phenotypes, genotypic ratio, and the phenotypic ratio of the following tri-hybrid cross. A male having genotype AABbCc mates with a female having genotype AaBbcc. Wherein: (A) (B) (C) is Long nose and (a) is flat nose is attached earlobes and (b) is unattached earlobes is thick eyebrow and (c) is thin eyebrowR d 4. (3) D R and D are linked; the distance between R and D is 10 cM. G is unlinked. Now, you test cross this individual. a) (1) What % of the progeny of the test cross will be dominant for both R and D (ignore G)? b) Now, using all 3 genes, figure out the % of each gamete and they should all add up to 100%. I did one for you (see below). Make sure you know how to do a problem like this. These gametes are: RDG Rdg rDG RdG 22.5% rDg RDg rdG6. In garden peas, round seeds ( R) are dominant over wrinkled (), yellow seeds ( Y) are dominant over green (y), purple flowers (A) are dominant over white (a) and tall plants (T) are dominant over short (t). Consider the following pea plants, and answer the questions below: Plant 1 = Rr Yy aa tt, Plant 2 = Rr Yy Aa Tt In a cross of Plant 1 x Plant 2, what proportion of progeny will: 6a. have the genotype Rr Yy aa tt? 6b. have the phenotype wrinkled, yellow seeds, white flowers, and short? 6c. have the dominant phenotype for all four characteristics? 6d. be pure breeding for seed shape?