If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the amino acid sequence it would make? Note: Use one-letter abbreviation for the amino acid sequence Sample answer format: MIGHTY
Q: What is genetic engineering? What organisms can it be performed on? Please give an example of at lea...
A: * Genetic engineering is also known as gene manipulation or modification. * It is a process to alter...
Q: Determine what the statement is describing. Fill in the blanks with the correct/best answer. 1. Gen...
A: Genetic engineering is the act of altering genetic material by interfering with genetic processes in...
Q: Rg of laterial that có (carbon) and 0.5% N (nitrogen) would likely be (assuming that 35% of the carb...
A: The composition of soil organic matter averages about 5% nitrogen and 50-60% carbon. A soil with 1% ...
Q: Select the statements that are true for lactic acid fermentation carricd out in muscle cells. O This...
A: The term fermentation is associated with a metabolic process that can be found in several microorgan...
Q: Enumerate the functions of spleen
A: The spleen is a lymphatic organ that is part of the body's lymphatic system. The spleen is responsib...
Q: QUESTION 4 Shown here is a graph illustrating data from the original Pulse-Chase experiment analyzin...
A: The correct answer is- rough ER
Q: When light hits the center of an ON-center receptive field, which of the following processes occur: ...
A: The following facts are required to be known to answer this question with logic:- Suppose there is ...
Q: Identify the stages of follicle development in the following images Primordial follicle Primary fol...
A: primordial follicle: single oocyte surrounded by a single layer of granulosa cells. Primary folli...
Q: Which of the following belongs to protists? Check all that apply. Archaea cyanobacteria slime molds ...
A: The term protista is derived from Greek word "protistos" meaning "the very first". The organisms are...
Q: Make simple diagrams tracing the life history of Schistosoma japonicum
A: Schistosoma japonicum: Schistosoma japonicum is a significant parasite and one of the main schistos...
Q: How Sunscreen or Sun Filter ingredient's SPF is measured?
A: As per Bartleby guidelines, we are allowed to answer only one question at a time, please post other ...
Q: What is done when there is a delay of stool examination?
A: Q. What is done when there is a delay of stool examination? Answer - When there is a delay of stoo...
Q: 2. Examine this pedigree chart. mode of inheritance is shown? Explain how you arrived at this decisi...
A: The pedigree chart shown here is a popular tool used in Genetics to explain the mode of inheritance ...
Q: 14. You are studying two strains of C. diptheriae and find that one strain is fully capable of causi...
A: Difference:- The difference between two strains of Corynebacterium diptheria, one of which can caus...
Q: hat is DNA
A:
Q: What is the morphology of the following cells? streptococci diplococci streptob...
A: Different shapes of bacteria Different shapes of bacteria are used to categories bacteria. Differen...
Q: Explain the anatomical concepts associated with the urinary system. Summarize this module’s key poin...
A: The nervous system is made up of neurons, which are specialised cells that can receive and transmit ...
Q: what is sex ? and what is anal sex ?..
A: Sexual intercourse is a reproductive act in which male reproductive organ enters female reproductive...
Q: Which of the following are mechanisms which prevent clotting under normal circumstances? Select all ...
A: Blood clotting is a complex phenomena which usually occurs when due to any reason blood vessels are ...
Q: Q14
A: The sensitiveness of an organelle to a particular stimuli is based on the fact that how it reacts in...
Q: 1. What could be the significance of the ability of flowering plants to produce seeds? What advantag...
A: Introduction :- A seed is an ovule that has been fertilised and contains the plant embryo. It will g...
Q: Suppose a genetically engineered fish escapes into the wild, what do you think would be the implicat...
A: If genetically engineered fish will enter a world where wild salmon are already in a precarious sta...
Q: What is a cysticercus in Class Cestoda?
A: Platyhelminthes are the groups of invertebrates organism which do not possess coelom and are also wi...
Q: Hypothesize as to why iron can have an impact on bacterial growth, particularly S. Typhimurium, S.e...
A: INTRODUCTION Iron is an essential element for bacterial growth. Because it's participation in tricar...
Q: How do flatworms affect human health and welfare?
A: Worms that are present in the phylum Platyhelminthes such as planarians, tapeworms, flukes are calle...
Q: ANSWER THE FOLLOWING QUESTIONS: 1. What do you think is the strongest evidence that there is an evo...
A: One of the strongest pieces of evidence of the evolution of biodiversity is fossils. They occur in s...
Q: Question:- Describe control strains used in the clinical microbiology laboratory and explain their ...
A: Standard strains (quality control strains) are microorganisms with well-defined susceptibility or re...
Q: is nature an art?
A: Nature can refer to the physical world made up of plants and animals.
Q: Explain periplasms and their importance
A: Introduction :- In Gram-negative bacteria, the periplasm is the gap between the inner and outer memb...
Q: Using the images provided below, develop your own dichotomous key through the format given. An examp...
A: The system by which scientists classify living species is known as biological categorization. Simila...
Q: If a plant that is heterozygous for all theses characters is crossed with a plant homozygous dominan...
A: Mendel choses seven different traits " Pea shape round or wrinkled Pea color green or yellow Pod s...
Q: 1) Scientific name of paddy is (a) oryza sativa (b) Triticum aestivum (c) Avenue sativa (d) zea ma 2...
A: Botanical name: The scientific name given to a certain plant species. It must adhere to the botanica...
Q: Formation and dissolution of clots is primarily regulated by hemolysis positive feedback negative ...
A: When platelets, proteins, and cells in the blood clump together, a blood clot forms. Your body devel...
Q: 3. Describe three systems that are negatively influenced by chronic stress and the mechanisms and th...
A: Introduction: Stress:•A long-term feeling of being pressurised and overloaded, with symptoms such as...
Q: What would happen to the red blood cells of a patient who was treated with 10% saline?
A: Red blood cells are the most common erythrocytes or blood cells in the circulatory system. It helps ...
Q: If an organism is 2n=12, How many chromatids are present in prophase of mitosis? 1. 6 How many bival...
A: The indirect process of cell division by which the somatic parent cell divides once to produce two d...
Q: Which of the following best describes C-3 photosynthesis? Check all that apply.
A: C3 mode of photosynthesis is an inefficient way of photosynthesis compared to C4 and CAM respiration...
Q: Downloads/OCR ExamBulder e 4um Fig. 17.2 i) The diameter of the Kupffer cell in the image is 9.1 cm....
A: Introduction: 80% to 90% of the body's overall population of fixed macrophages are specialized tissu...
Q: What are the differences between the life cycles of trematodes and cestodes?
A: Introduction: Trematodes and cestodes are parasitic worms, they both belong to the kingdom Animalia....
Q: What causes platelets to adhere to the wall of a broken vessel? exposure of collagen fibers histam...
A: Hemostasis is the process through which the body prevents wounded blood vessels from bleeding. Too l...
Q: Placentals Marsupials Monotremes Mammals AMNIOTA Birds Crocodiles Lizards + Snakes TETRAPODA Tuatara...
A: Agnathans are different class from Gnathostomata. So it is placed as a different node in the table w...
Q: What are the qualities of an appropriate sequence in DNA chromatogram? Why?
A: Introduction: DNA stands for deoxyribonucleic acid. It's made up of nucleotides, which are biologic...
Q: What does a MEGA plate tell you about your microbial culture?
A: Microbiology is a discipline of biology that studies creatures that are too small to view with the n...
Q: what are the different taxonomic classifications of protozoans
A: Introduction :- Protozoa are heterotrophic, unicellular eukaryotic organisms. They can either live f...
Q: Which of the following statements are correct? * Extended trade territories, increased travels as we...
A: Due to extension of territories, travel and increasing in human population , an infectious disease ...
Q: Use the genetic decoder provided to assist in answering this question.\ Second letter A UUU UUC Phe ...
A: Introduction: The process of polymerization of amino acid to form a polypeptide is called translatio...
Q: omplete the colony morphology for the colonies pictured above: 1. Form - 2. Elevation - 3. Mar...
A: Morphology of the colony includes 1.Form : There are many forms for a colony . Circular Irregular ...
Q: Which part of your body is denser than water, therefore, to help you sink in the water? (Check all t...
A: We know that human body will swim to some extent if it is submerged in water. Our body is made up of...
Q: What is the significance of mapping the human genome?
A: Human genome : It is a complete set of nucleic acid sequences for humans , encoded as DNA within the...
Q: Lactate is usually removed from the muscle cells by a(n) that also transports O antiporter, H* O ant...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the amino acid sequence it would make?
Note: Use one-letter abbreviation for the amino acid sequence
Sample answer format: MIGHTY
Step by step
Solved in 2 steps with 1 images
- If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the amino acid sequence it would make? Note: Use one-letter abbreviation for the amino acid sequence Sample answer format: MIGHTYA portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
- Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
- In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Use the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?
- A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Note, the answer blanks for mRNA may appear vertically on some displays. In this case, enter the bases from top to bottom. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. Enter the full, unabbreviated name of the amino acid in the blank provided. In the case of a stop codon, enter "Stop"For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G