In translation, the sequence of nucleotides in mRNA, is converted (translated) to a sequence of amino acid residues in a polypeptide. Translation involves three types of RNA: transfer (tRNA), messenger RNA (mRNA), and ribosomal RNA (rRNA). Determine whether each of the items below are associated with tRNA, mRNA, or rRNA. a) codon b) anti-codon c) combines with protein to form ribosomes d) carries genetic information from nucleus to cytoplasm e) transports amino acids

In translation, the sequence of nucleotides in mRNA, is converted (translated) to a sequence of amino acid residues in a polypeptide. Translation involves three types of RNA: transfer (tRNA), messenger RNA (mRNA), and ribosomal RNA (rRNA). Determine whether each of the items below are associated with tRNA, mRNA, or rRNA. a) codon b) anti-codon c) combines with protein to form ribosomes d) carries genetic information from nucleus to cytoplasm e) transports amino acids

Name: Can you help me to explain to me because i struggled with my homework?
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Can you help me to explain to me because i struggled with my homework? In translation, the sequence of nucleotides in mRNA, is converted (translated) to a sequence of amino acid residuesin a polypeptide. Translation involves three types of RNA: trans

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

Consider this list (below) of steps involved in translation. These steps are out of order. TRANSLATION: 1. the small and large ribosomal sub-units unite2. two amino acids join together.3. another tRNA anti-codon bonds with another mRNA codon 4. an initial tRNA bearing a specific amino acid arrives at the ribosome 5. the process continues until a protein molecule is completed6. at the synthesis site, initial mRNA codons are inserted
Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the ribosome. b) The tRNA is the same thing as the amino acid. c) There are two binding pockets within the ribosome where different tRNAs will bind to the mRNA. d) The first codon that is recognized by the ribosome is UAG e) The ribosome can bind to the mRNA in any location.
A segment of template DNA is known to contain the following base sequence: 3' GATACCTTTGTGTAGTCATCTT 5' a) Write the mRNA that would be transcribed from this DNA fragment. b) Highlight the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. asap please
Explain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA. Include names of any relevant sequences on the mRNA, proteins involved, including ribosomal subunits.
Which of the following parts of translation is significantly different in eukaryotes and prokaryotes?Question 25 options: A) the presence of a start codon B) the genetic code C) Initial binding of mRNA by ribosomes D) movement of mRNA and tRNA through the 3 sites on the ribosome E) binding of tRNAs to mRNAs
Which of the following is an example of the degeneracy of the genetic code?Group of answer choices a) each codon specifies more than one amino acid b) the genetic code is not degenerate c) an amino acid can have more than one codon d) None of the above
Which of the following is NOT true regarding the genetic code and translation? a) An mRNA is typically translated in only 1 reading frame. b) There are 64 different codons. c) Multiple amino acids may be coded for by a single codon. d) mRNA sequence is the reverse complement of the template strand of DNA.
The 3 major forms of RNA (mRNA, tRNA, & rRNA) interact during translation. a) Describe the role of each form of RNA during translation.
A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)
Translation is the process by which the sets of 3 bases (codons) of the mRNA are read to specify the sequence of amino acids for the protein to be produced. Using the genetic code data provided, find the sequence of amino acids that would correspond to the MRNA codons shown. Codons 1 3 MRNA A UGUGGAUC CGAG UCACG Amino acid SECOND LETTER A U UUU Phenylalanine UCU UCC Serine (S) UAU Tyrosine (Y) UAC TAA stop codon UAG stop codon UGU Cysteine (C) UGC TỮA Leucine (L) TGA stop codon UGG Tryptophan (W) F UCA UUG UCG I H CUU CCU CAU Histidine (H) R CGU CỨC Leucine (L) CỦA CCC Proline (P) ССА CCG CGC Arginine (R) CGA CAC "CAA Glutamine CAG (Q CUG CGG G D A AUU L AUC Isoleucine (1) AAU Asparagine AAC (N) ÄÄÄ Lysine (K) AGU Senine (S) ACU ACC Threonine ACA (T) AGC E AUA AGA Arginine (R) E ACG T AUG stat codon (M) AAG AGG TG GƯỮ GAU Apartic acid GAC (D) "GAÄ Glutamic acid GCU GGU GUC Valine (V) GUA GGC Glycine (0) GCC Alanine (A) CE GCA GGA R GUG GCG GGG GAG (E) The start codonencodes the amino…
Describe in detail all of the steps necessary to carry out translation. Amino acids, mRNA, 30S ribosome, 50S ribosome, tRNA, protein chain, E site, P site, and A site.