In the given segment showing parallel strands, there are a total of In a parallel 3 sheet, hydrogen bonds are formed between on the opposite strand. peptide chains. on one strand and
Q: Which of the following pair of substances are products of the citric acid cycle? a) Acetyl CoA and…
A: Introduction: The citric acid cycle also known as Kreb's cycle is the final common oxidative…
Q: 4. Cis peptide bonds are rarely found in proteins because they are about 8 kJ/mole less stable than…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: Which of the following substances is the precursor of Cholesterol ? I.bile salts II. testosterone…
A: Cholesterol is a type of lipid that acts as the component of plasma membrane and maintains the…
Q: Which of the following fatty acids is NOT common and naturally occurring?
A: In-order to answer this question, first we have name these fatty acids numerically. For this ,…
Q: Which of the following statements is/are TRUE for the Krebs' cycle? Reaction 1: condensation of…
A: Krebs cycle is the typical process for fully oxidising proteins, lipids, and carbohydrates as they…
Q: How would you briefly describe what a metabolic pathway is?
A: the set of reactions leading to final product via various transformation of a compound is…
Q: he Calvin cycle can be divided into which two stages? a.Preparation, fixation, reshuffling,…
A: Calvin cycle or C3 cycle can be divided into three main stages: 1. Carbon fixation 2. Reduction 3.…
Q: 5. What is a reducing sugar?
A: Reducing sugar means that sugar can reduce some other molecules. A molecule that can reduce some…
Q: 5. Specific properties of amino acids in the organism: a) deamination; b) transamination; c)…
A: Amino acids are the building blocks of proteins, its alpha carbon contains carboxyl group, amine…
Q: In this FRET data table, an antibiotic was added, but the type was not recorded. According to the…
A: FRET (Förster resonance energy transfer) is a technique in which energy transfer between two…
Q: 9. A patient with liver failure underwent a study of the electrophoretic spectrum of serum proteins.…
A: Proteins are the complex molecules that are made up of Aminoacids. They have definite charge that is…
Q: Which of the following statements is/are FALSE for the Krebs' cycle? It is an amphibolic process.…
A: Under aerobic conditions, the pyruvate molecules that are synthesized as the end product of…
Q: Which of the following is/are (a) ketopentose? A. threose B. xylulose C. arabinose D. mannose
A:
Q: Structure and Function of DNA and RNA
A: DNA and RNA are nucleic acid which is comprise of nucleotide base (adenine, thymine, guanine,…
Q: How can one confirm/investigate the type of inhibition exerted by AZT on the HIV reverse…
A: HIV stands for human immunodeficiency virus which causes AIDS and interferes with the body's ability…
Q: f) As ATP is used, the above, at what ratio of equilibrium)? phosphocreatine stores are depleted.…
A:
Q: Mention all the enzymes and reagents used in the everse Transcriptase Polymerase Chain Reaction…
A: RT PCR is Reverse transcription polymerase chain reaction. This a process used to generally…
Q: 35. What is the approximate pl for the peptide MEKVDRP. Because this is a peptide, assume the pka…
A: Peptide : Peptides are short or small chains of amino acids having about 2-50 amoino acids. As amino…
Q: The amino acid histidine has ionizable groups with p?a values of 1.8, 6.0, and 9.2, as shown. A…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: A pentapeptide has a titration curve that shows five inflection points for five equivalents of…
A: Amino acids contain ionizable groups. The ionic form of the amino acids depends upon the pH of the…
Q: Will dithiothreitol have the exact same effect on folded proteins or will the reaction undergo a…
A: Dithiothreitol (DTT) is a small redox reagent which is also known as Cleland's reagent. It is…
Q: Match the following - Secreted by B cells of the pancreas ✓ Secreted in response to high blood…
A: PART 1 Pancreas is a gland and an organ,both at the same time. Glands are those organs which produce…
Q: The major source of metabolic acid in the body is carbon dioxide owing to its ability to be…
A: Given to us are 5 acids and we are asked to determine which one out of the 5 are produced from…
Q: Which of the following are elongation factors involved in the release of free tRNAs? a.EF-G…
A: The above mentioned elongation factors are involved in the process of translation in prokaryotes.…
Q: Which of the following is/are (a) ketose? A. tagatose B. lyxose C. erythrulose D. allose
A: Sugars or carbohydrates are the most abundant biopolymers in living organisms. Carbohydrates are…
Q: In the chain elongation of proteins, the new aminoacyl-tRNA bonds to? a.A site b.E site c.G site…
A: Translation is process by which the cells produce protein from the information provided by the DNA.…
Q: Which statement about the ETC is/are FALSE? A. Cytochrome c is freely moving and faces the…
A: Electron transport chain (ETC) is a series of electron transporting complexes present in the inner…
Q: at is the effect of adding neurotoxins to the Motor neuron membrane and muscle membrane potentials?…
A: Introduction: Neurotoxins are poisonous substances that cause destruction to the nerve cells. It…
Q: Consider the following peptide to answer the questions below: A M A K K E S H I F T A I D E What…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.Ile and…
A: Proteins are made up of amino acids and these amino acids are linked via peptide bond. The amino…
Q: I have the substrate concentration as 20, 40 , 65 and the V(mol/min) no inhibitor 602, 690, 833 and…
A: MM plot is Michaelis menton plot that is constructed with Substrate concentration on x axis and Vo…
Q: What are pantothenic acid and biotin? Explain how these molecules are important to cellular…
A: The cell perform multiple metabolic pathways in order to maintain the life processes. The major…
Q: The total concentration of enzyme in a reaction, [E], is made up of the concentration of enzyme…
A: An enzyme catalyses the reaction S ⇌P. The rate of the reaction depends on the concentration of…
Q: Explain the role of zinc in biomolecules .
A: Zinc is the micro nutrient and is considered as the third most abundant element in the body. It has…
Q: Please provide research data that support the occurrence of Cytokine storm in humans
A: Cytokines are proteins that play an important role in controlling the growth and activity of other…
Q: The Na+/K+ ATPase pump is a P-type pump and requires a covalent phosphorylation from a phosphate…
A: ATPase is the most common example of primary active transport. Virtually every animal cell…
Q: Which of the following is CORRECT about the movement of e- in photosynthesis? A. H20 → Pheo → PQ →…
A: This question is from LIGHT REACTION. Light reaction is of 2 types:- 1. Cyclic 2. Non cyclic ( z…
Q: what is PTM: • Hydroxylation (requiring VitaminC) • Glycosylation
A: PTM stands for post translational modification. It is modification of proteins which includes…
Q: Voltage-gated K+ channel senses voltage across the plasma membrane and permits selective passage of…
A: A rapid and large changes in membrane potential of nerve cells during which the potential actually…
Q: Which of the following statements about cellular membranes is/are FALSE? A. Only lipids move Within…
A: Cell membranes serve as both organisers and protectors. An outer plasma membrane surrounds every…
Q: Which of the following enzyme components of fatty acid synthase has/have a thiol group? A.…
A: Introduction: Enzymes are the biological catalysts that accelerate the rate of chemical reactions.…
Q: Explain why these two DNA samples give different results, when they're both 50% G-C. Fraction of DNA…
A: We know that E. coli is a prokaryote and Potoroo is an eukaryotic animal. The stability of DNA is…
Q: Active transport requires energy released by an exergonic process such as the formation of ATP…
A: Active transport system requires energy in order to allow the movement of molecules, mostly the…
Q: First start with a pre-MRNA with four exons and three introns and diagram the splicing reactions…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: 1. What is mucic acid? 2. What is the principle involved in mucic acid test?
A: When nitric acid oxidizes both the C1 aldehyde and the C6 primary alcohol of an aldose, a saccharic…
Q: Which of the following statements is/are TRUE? A. Cells in a resting metabolic state have low ATP…
A: Introduction: Lipid is one of the important sources of energy required for our body. It primarily…
Q: Food industry a. The importance of recombinant DNA technology in food industry b.…
A: Introduction Recombinant DNA technology (RDT) is a process by which DNA of an organism is altered in…
Q: 1. A 2M NaCl solution and a 2 M glucose solution are separated by a semi-permeable membrane,…
A: Osmosis is the movement of water across the semipermeable membrane driven by the difference in…
Q: Given the structures of the nitrogenous bases shown in the picture, draw the structure of a part of…
A: The nitrogenous bases shown in the figure are Adenine (A), Guanine (G), cytosine (C), uracil (U) and…
Q: Which of the following fatty acids will produce propionyl-CoA in its/their last β-oxidation cycle?
A: Fatty acids metabolism involves β-oxidation which happens in the mitochondrial matrix. In…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- GT 3 A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this pentapeptide? 1. Show a tertiary structure of ACGGC after a disulfide bond forms. A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C-terminal) of the resulting fragments, deduce the sequence of the original peptide. 2. 3. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-GIn-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Metdisadvantage of using protein blastCell wall bullding block D-Ala-D-Alal-Lys-tail NH,Me Heptapeptide backbone R1 R. R2 ii) With the aid of the figure above showing the important features of the binding of Vancomycin (lower part) to a bacterial cell wall peptia discuss the antibiotic effect of Vancomycin. i) Vancomycin resistant strains often have a mutation in which one of the D-Ala moieties is exchanged to a D-lactate moiety. Discuss why this mutation makes the strain Vancomycin- resistant but still viable. iv) Glycoconjugate vaccines based on bacterial capsular polysaccharides have been used for 30 years without any need for changes in their structures, while the flu vaccine, based on attenuated or killed virus particles, requires many different structures and a check each time when there is an epidemic that the right vaccine is used. Discuss the reason behind this.
- Antiparallel B sheet 寧 ; Ala side chains Gly side chains Figure 4-14a Lehninger Principles of Biochemistry, Seventh Edition 2017 W. H. Freeman and Company The structure of spider silk is shown above. Mutating the alanine residues to arginine is expected to disrupt the beta sheet structure. Please provide two reasons why mutating the alanine residues to arginine would be expected to disrupt the beta sheet structure.Complementation and mapping analyse of Lac− mutantsExplain the advantage of using Fluorescence Recovery After Photobleaching (FRAP) in determining protein localisation I notes = Notes Comments MAY 7.
- GT 3 A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this pentapeptide? Show a tertiary structure of ACGGC after a disulfide bond forms. A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C- terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met.A protein gives a single band on SDS gel electrophoresis, as shown in lanes 1 and 2 below. There is little if any effect from addingSequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
- e.) ( acid buffer an appropriate choice? Why or why not? If I need to perform an enzymatic reaction at pH 6.5, is a citric )Describe the process of transcription in as much detail as possible using pictures and words beginning with a paired (duplexed) strand of DNA and ending with a processed mRNA which is ready for translation. 7.Modify methionine to show its zwitterion form. Select Draw с N 0 Templates S H More 1C || H0 C 1 с | CH₂ | CH₂ | S 1 CH3 HIN I N-H Erase Q 2 QWhat is the function of sodium dodecyl sulfate (SDS) in SDS-PAGE? stabilizes the gel matrix, improving resolution during electrophoresis SDS solubilizes proteins to give them uniformly negative charges, so the separation is based purely on size. SDS raises the pH of the gel, separating multiunit proteins into individual subunits. SDS solubilizes proteins to give them uniformly positive charges, so separation is based purely on pH.