If tRNALeu is mutated so that it is recognized by the tRNAVal synthetase but not the by tRNALeu synthetase, how will the following peptide sequence change upon mRNA translation? wild-type: Met-Lys-Leu-Pro-Ala-Leu-Val-Val-Ala O Met-Lys-Leu-Pro-Ala-Leu-Leu-Leu-Ala O Met-Lys-Val-Pro-Ala-Val-Leu-Leu-Ala O Met-Lys-Val-Pro-Ala-Val-Val-Val-Ala
Q: Asexual reproduction passes on 100% of the parent's genes but it is relatively rare. What are the…
A: Reproduction It is a biological process through which the new individuals are produced from their…
Q: Modified TRUE or FALSE. Write T if the statement is completely TRUE and if false, change the…
A: Neurons are the functional units of the nervous system. The signals travel through the neurons in…
Q: The algal group from which green plants have probably arise, also show evidence that suggests this…
A: Algae are unicellular, photosynthetic, aquatic eukaryotic organisms that belong to the Protista…
Q: 65. Which of the following fibers provides the only output of the cerebellar cortex? A) Climbing…
A: Purkinje cells are the most striking histological feature present in the cerebellum. Dendrites…
Q: Which of the following traits are unique to only Homo sapiens and not to Australopithecus or…
A: Australopithecus is a genus of early hominins that existed in Africa during the Late Pliocene and…
Q: Given your knowledge of how species evolve, why is it not likely that speciation will occur in the…
A: Given your knowledge of how species evolve, why is it not likely that speciation will occur in the…
Q: Darwin and the Theory of Evolution - V2 So how and why did Charles Darwin come to develop his…
A: The theory of evolution is founded on the assumption that all species are connected and evolve over…
Q: Should molecular traits be used to classify human begins?
A: Molecular traits include gene expression , methylation and metabolite levels. Classification…
Q: Explain what happen during anaerobic
A: INTRODUCTION The anaerobic organisms during their cellular respiration the don't use oxygen for…
Q: 3. Draw a photosystem and label the parts.
A:
Q: How does DNA profiling make use of genetic variation in DNA sequences
A: DNA profiling is also called DNA fingerprinting.
Q: seems that the expert only addressed the background of prorooncogen and the impact of Ras causing…
A: Protooncogenes are the genes that form the proteins that are responsible for cell division and cell…
Q: To enlist: The adaptations of gymnosperm that have helped them become the dominant tree in dry, cold…
A: Plants whose seeds are exposed on the surface of cone scales are known as gymnosperms. Adaptations…
Q: In squirrels, individuals that are heterozygous for the mutant LDL receptor gene( Fa) begin to…
A: In the case mentioned above, the squirrels experience heart attacks quite early when they have both…
Q: 3-week-old male newborn who was delivered vaginally at 33 weeks' gestation has a bulging anterior…
A: A shunt is a flexible tube or catheter which is specifically placed in a specific position in the…
Q: To describe the life cycle of the typical bread molds.
A: The zygomycetes are a relatively small group in the fungi kingdom and belong to the Phylum…
Q: 61. Degradation of glycogen in muscle fails to supply significant amounts of blood glucose because…
A: 61. Degradation of glycogen in muscle fails to supply significant amounts of blood glucose because…
Q: More recent additions to the hominan phylogeny such as Ardipithecus pushed hominan origins back ~4.4…
A: The correct answer choice is - suggest that bipedalism may not be strictly related to savannah…
Q: To describe the six main taxonomic groups of fungi and also explain the reason that some fungal…
A: As per our company guideline we are supposed to answer only first question. Kindly repost other…
Q: Lab Data Tube 1 White Light Volume (ml) 3.3 4.5 5.7 6.8 8.2 сл Time (min) Tube 2 Covered Volume (mL)…
A: Rate of volume change = final volume - initial volume/time × 60 Rate of volume change for tube 1…
Q: Introduce and explain comprehensively the process of calculating the final magnification of…
A: A microscope is a device that magnifies an object so that the spectator can see it. A microscope is…
Q: ) Suppose that in a species of flowering plant, we cross a plant with red flowers with a short stem…
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: C-reactive protein interacts with A) factor D B) C1 C) factor P D) C4 E ) C2
A: Complement system includes components which are made up of proteins or glycoproteins. These are…
Q: A diploid trihybrid plant was testcrossed. Each of the three genes determines a single Mendelian…
A: Let's represent the three genes as A, B and C. The two parents that were crossed to form the diploid…
Q: Paroxysmal nocturnal hemoglobinuria is a disease characterized by lysis of red blood cells, which…
A: INTRODUCTION Paroxymal nocturnal hemoglobinuria This is a life threatening disease caused by the…
Q: Orque (Orcinus arco) Goéland marin (Larus marinus) Crabe des neiges (Chionoecetes opilio) x Etoile…
A: The food chain is the arrangement of organisms in a linear sequence in which the nutrients and…
Q: StompOnStep1.com a. Assume this pedigree represents inheritance of a human disease. What is the most…
A: The given pedigree has the following - (i) it does not skip generations (ii) the trait is passed…
Q: What are the differences between scanner, low power objective, high power objective and oil…
A:
Q: 28. A 62-year-old man has adenocarcinoma with lymph node metastases in the proximal portion of the…
A: Introduction Cancer is caused due to uncontrolled and abnormal division of the cells of the body.…
Q: 17. Which of the following is the CORRECT base pairings in RNA? * A. Uracil and Adenine B. Thymine…
A: Introduction :- A base pair is a basic unit of double-stranded nucleic acids, consisting of two…
Q: Hello, thanks for the response. Parts B and C are not answered. I believe the rule is 1 question…
A: VNTR is a type of tandem repeat in a DNA sequence in which a short sequence of nucleotide are…
Q: 1. List the stages of photosynthesis and their location within the cell.
A: Photosynthesis is the process by which plants make food using carbon dioxide, water and sunlight.
Q: What does the Myxoma virus introduction into the rabbit population of Australia teach us about viral…
A: The Myxoma virus (MYXV) is prevalent and nonlethal in South American forest rabbit colonies;…
Q: 2. The rising of nanotechnology paved way to discover new trends, one of which is the discovery of…
A: The proteins are formed when ribosomes read an mRNA. The base triplets or codons on the mRNA are…
Q: 6. Which of the following labeled structures in the MRI of the head receives projections from spinal…
A: Introduction :- Brain tumours, traumatic brain injury, developmental defects, multiple sclerosis,…
Q: Write advantage and drawbacks of RISA (Ribosomal Intergenic Spacer Analysis) technique. What is the…
A: Ribosomal Intergenic Spacer signifies the intergenic region between the small and large subunits of…
Q: Please answer fast Suggest how the weak points of the molisch test for carbohydrates can be…
A: Introduction :- When concentrated hydrochloric or sulphuric acid is added to Molisch's test, the…
Q: 6.6 Describe crossing over. Explain how it is related to recombination
A: Ques : Describe crossing over. Explain how it is related to recombination
Q: In our body, an enzyme called ______________ help break the bond between two monosaccharides when…
A: Digestive enzymes are proteins which aid in the digestion of food. The saliva glands and cellular…
Q: Adenosine Triphosphate (ATP) is the energy currency of the cell in any metabolic activity of the…
A: Adenosine triphosphate (ATP) is a three-phosphate nucleotide. The addition of phosphorous to the…
Q: The best example of a population in the list below is the a tiger salamander tadpoles in 2006.…
A: A population comprises individuals of the same species. Population of different species together…
Q: State the expected ratio of ebony to non-ebony flies in the F2 generation. State the expected…
A: The Ebony, non-Ebony, Stubble and non-Stubble are the phenotypic characteristics of a fly. According…
Q: The reason that why some fungi produce antibiotic chemicals.
A: Fungus is a type of eukaryotic organism belonging to the kingdom Fungi, alongside plants, animals,…
Q: Create a maximum 2-page discussion that details the history of vaccines, their advantages and…
A: An individual may be exposed to an antigen to induce immune response a type of immunity known as…
Q: 4. Describe the pathogenesis of patient's disorders in the pigment exchange. 5. What changes in…
A: Hepatitis happens when your liver becomes inflamed, often due to a viral infection. Alcohol…
Q: A 50-year-old woman has diminished vibratory sensation on her right arm. Which of the following…
A: The brain and the spinal cord are the two main organs of the central nervous system. Spinal cord…
Q: The non-wild-type alleles are k (clipped wings), l (long tail), and m (magical powers). The parental…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: What are the basic components of a Fluorescence Microscope and what are the functions of each? Are…
A: Microscopes are laboratory instruments that are used to view and study things that cannot be seen…
Q: 47. Which of the following regions of the retina is capable of the highest spatial resolution and…
A: Introduction :- The retina connects the light that enters your eyes to the images that you see. Your…
Q: To determine: The features of a fungus's body structure that is related to its method of acquiring…
A: Organisms that are neither plants nor animals are classified as fungi. Yeasts, moulds, and mushrooms…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUUsing the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
- What amino acid sequence does the following mRNA nucleotides sequence specify? 5'- AUGGCCAGCUGU -3' Express the sequence of amino axis's using the three-abbreviations, separate hyphens (e.g., Met-Ser-Thr-Lys-Gly).A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)Translate the following mRNA: 5-A U G A A A U U U C U U U A G G U C G A A -3 NH3+- Met-Leu-Phe-Val- COO- NH3+- Met-Thr-Val-Ser- COO- NH3+- Met-Glu-Gln-Ser- COO- NH3+- Met-Asp-Ser-Pro- COO- NH3+- Met-Lys-Phe-Leu- COO-
- A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition= lys-ser-pro-ser-leu-asn-ala-ala-lys mutant form= lys-val-his-his-leu-met-ala-ala-lys. Decipher the segment of mRNA for both the original protein and the double mutant. Which base was added? Which was deleted?Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'): AUGCCUGACUUUAAGUAGWhat are aminoacyl-tRNA synthetases?