If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the amino acid sequence it would make? Note: Use one-letter abbreviation for the amino acid sequence Sample answer format: MIGHTY
Q: Picture this: You are on the verge of completing a key experiment for your PhD dissertatic project.....
A: To calculate working concentration from stock, this formula can be used N1V1=N2V2 N1 -concentration ...
Q: How do proteins regulate fluid balance? A. Proteins repel water. B. Proteins attract water. C....
A: Protein is a necessary macronutrient, but not all protein-rich foods are made equal. Protein may be ...
Q: Draw the Gentiobiose: 2 Glucose, beta-(1,6)
A:
Q: A 50.0 ml juice extract is colorimetrically assayed using Nelson's test. One milliliter (1.00 mL) of...
A: Answer: Principle: Nelson Somogyi method is a version of Somogyi'stitrometric method for use with ...
Q: WHAT ARE THE PURPOSE OF THESE TESTS: Molisch test, Benedict’s test, Nylander’s test, Osazone’s test,...
A:
Q: make the test principle, materials required for the analysis, sample preparation, test procedure, in...
A: A variety of organic compounds exist in nature. Among them, the nitrogen-containing organic compound...
Q: III. Acrolein Test (Record the odor; write pungent or not pungent) Glycerol Coconut Oil Paraffin Oil...
A: Acrolein Test: A test to detect the presence of glycerol and other fat. Here a dehydrating agent Pot...
Q: In full details. Explain the significance of redox potentials formed by redox pairs in the electron ...
A: Redox Reaction: This is a type of reaction which is a combination of both oxidation and reduction re...
Q: 1. What is the common metabolic pathway of these three nutrients? Explain the process involved. 2. M...
A: Since the name of the three nutrients is not mentioned in the first question, we consider it incompl...
Q: A. Signal transduction in cells can happen in two fundamental ways once a signal arrives at the cell...
A: All the cells respond to the signals they receive from their surrounding. The steps involved in the ...
Q: You are about to isolate a 3000 bp large plasmid from an E.coli culture. You know that the plasmid i...
A: 1 DNA bp weight = 650 g Given : 100 plasmid copies per cell Plasmid concentration= 100 ng/microL
Q: hydrolysis of sucrose and starch
A: Benedict's test: When a reducing sugars are heated in the presence of alkali they get converted to e...
Q: With the exception of Dermatan, the repeating disaccharide unit of glycosaminoglycans consists of ur...
A: The question is about the repeating disaccharide that found in the tissues of mammals in mucus and f...
Q: Draw (be specific on the structures of each component in the cycle) and explain the entire process o...
A: The citric acid cycle is also known as the TCA cycle. It occurs in the matrix of mitochondria. It in...
Q: Upon treatment with phenylhydrazine reagent & hydrolysis, maltose gives glucuronic acid and glucosaz...
A: In the reduction reaction, the aldehyde or keto group of monosaccharides is reduced to the appropria...
Q: The metabolism of alcohol pathway is showed in the figure characterized by biotransformation of: (F...
A: Metabolism- The primary enzyme involved in the metabolism of alcohol is ADH( Alcohol dehydrogenase)...
Q: cell wants to synthesize the a(1→4) dimer from two glucose molecules. Show the mechanism.
A:
Q: True or False. Write the word “reducing” if the statement is correct, otherwise write “non-reducing”...
A: Mutarotation is the change in the optical rotation as change in the equillibrium between two anomers...
Q: From the complete oxidation of glucose (glucose → 6CO2), how many total NADH electron carriers are p...
A: For complete oxidation of one glucose molecule, tge pyruvate produced by glycolysis has to undergo t...
Q: WHAT IS THE PRINCIPLE, APPLICATION, AND RELEVANCE OF THE FOLLOWING IN TESTING THE CARBOHYDRATES? -Mo...
A: The mentioned tests are for carbohydrates.
Q: The estimated energy need for a moderately active 16-year-old male is 2,800 kilocalories/day; for a ...
A: Food is made up of a wide range of nutrients including carbohydrates, fats, proteins, vitamins, mine...
Q: True or False 1. Salivary amylase can be use to hydrolyze beta1,4 glycosidic bonds of cellulose. 2. ...
A: Those organic molecules that help in the growth and development of the body by performing specific f...
Q: Question 10 The proteins and other substances that bind to the DNA rely mostly on non-covalent inter...
A: A substance that is mainly made up of carbon, hydrogen, oxygen, nitrogen, sulfur, and phosphorus pre...
Q: QUESTION 5 Which of the following amino acids is most unlikely to be present in a beta sheet? Isoleu...
A: In the β-pleated sheet, the sheet are formed due to hydrogen bonding between atoms on the peptide ba...
Q: PLEASE PLEASE ANSEER ALL
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and s...
Q: Which of the four classes of amino acids has side chains with the greatest hydrogen-bond-forming pot...
A: Amino acids are building blocks of protein. 4 types of Amino acids are - Polar & acidic Polar &...
Q: You suspect that the mRNA encoding the guanine biosynthetic genes of Bacillus subtilus contains an a...
A: Before we get into figuring out a way to test the above hypothesis, we need to have a good idea on t...
Q: Would lactose + lactase be positive or negative for the Iodine test?
A: Lactose is a disaccharide that is commonly found in milk. Lactose is also known as milk sugar. Lacto...
Q: What is the difference between lock-and-key and induced-fit models for binding of a substrate to an ...
A: Enzymes: Most of the enzymes are protein in nature and they fasten the speed of the reaction. All e...
Q: What role do glycocalyces play in the ability of bacteria to survive and cause disease? (use at leas...
A: The cell envelope in bacteria consists of three layers namely, the outermost layer of the glycocalyx...
Q: DRAW 22:6A 4,7,10, 13,16,19 What Omega wa family Hhis fatty Acid Belong 22:6A4,7,10,13, 16, 19 what ...
A: The fatty acids are carboxylic acids with a hydrocarbon chain. They are the simplest form of lipids....
Q: What is the function of the flame in AAS? O lonozation of sample O Atomization of sample O boling of...
A: Answer The function of flame in AAS - Atomization of sample
Q: 1. Differentiate starch from cellulose and carb 2. In which solvents or solutions will a lipid be a....
A: Since, you have posted a question with multiple sub-parts, we will solve first three sub-parts for y...
Q: Answer the following questions, showing work in the form of calculations. a) At what substrate conce...
A: Michaelis-Menten equation: Leonor Michaelis and Maude Mented created a simple model that accounts f...
Q: What are the glycosidic linkages in this structure
A: A glycosidic bond, also known as a glycosidic linkage, is a form of covalent binding that connects t...
Q: ive the functions of the following ingredients, then name a branded/commercial skin or hair care pro...
A: 1. BETAINE: It is also called as betaine anhydrous, or trimethylglycine (TMG), which is synthesized...
Q: In full details Define each of the following and explain the role of each in named cells: i. Thermo...
A: I) Thermogenin: Thermogenin or uncoupling protein which is now known as uncoupling protein 1, or UCP...
Q: From the complete oxidation of glucose (glucose > 6CO2), how may total NADH electron carriers are pr...
A: The metabolic pathway that breaks down glucose and produces ATP is known as cellular respiration. Gl...
Q: How many exons does tra-RA contain? Q7. How many introns does tra-RA contain?
A: Gene is a portion of the genome that can be transcribed or a functional unit of the geno...
Q: What is the function of the buffer protein in the human body?
A: There are 3 types of buffer systems in our body. They are protein buffer system, phosphate buffer sy...
Q: Concerning the process of the aerobic fate of glucose oxidation, false? The spontaneous movement of ...
A: In the mitochondrial electron transport chain, electrons flow when the reduced electron (NADH, FADH2...
Q: what is a hydration number
A: Hydration refers to the interaction of a molecule or substance with water. Water interacts with seve...
Q: QUESTION 30 Below is a standard curve generated by taking absorbances of standard solutions at conce...
A: Proteins are the biomolecules which are composed of amino acids. The concentration of proteins can b...
Q: Which of the following are repeating disaccharides of polysaccharides are often found in mucus and f...
A: There are three classes of glycosaminoglycan is present in joint. Those are Chondroitin sulfate, ker...
Q: Consider the following metabolic pathway and answer the questions. CH,OPO, CHOPO, H--OH HO-C-H H-C-O...
A: Hi, thank you for posting the question on Bartleby. As per the guidelines, we can answer up to three...
Q: . Associated with severe hypertriglyceridemia a. LDL predominantly increased b. HDL is predominantly...
A: Multiple questions asked. I will answer the 1st question, following guidelines. Please repost others...
Q: how monosaccharides attach to the pentasaccharide core?
A: Monosaccharides are simple sugar having usually carbon range from 3 to 7 carbons. Monosaccharides c...
Q: Supercoiling of DNA requires GTP as source of energy is only observed in prokaryotes is no...
A: DNA is a genetic material present in most living organisms. In case of eukaryotic cells DNA is found...
Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H. H,N-C-COOH ...
A: Amino acids are chemical molecules that combine to produce proteins and are hence known as building ...
Q: Given the statements identify which are correct or incorrect
A: Multiple subparts asked. I will answer the first 3 subparts; following guidelines. Ketose - Monosacc...
If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the amino acid sequence it would make?
Note: Use one-letter abbreviation for the amino acid sequence
Sample answer format: MIGHTY
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…Genetic Code-Reference Second Letter First Letter C Third Letter UAU] UACS **UAA Stop UGU] Cys UGC U UUU Phe UUC UCU Туг UCC U Ser UUA) Leu UUG **UGA Stop UGG Trp UCA UCG **UAG Stop CUU CCU CAU) CGU His CACJ CAA) CUC CCC CGC Leu Pro Arg CUA ССА CGA A Gln CUG CCG CAGJ CGG AAU] AGUSer U AUU ACU AACAsn AAA Lys AUC Ile ACC AGC C Thr AGA] Arg AUA ACА AAGJLYS GAU] GACASP *AUG Met/Start ACG AGG U GUU GCU GGU Asp GUC GCC GGC Val Ala Gly GAA) Glu GAGJ GUA GCA GGA GUG GCG GGGThe following questions refer to this table of codons. Second Base U A G UUU UCU UAU UGU ] Cys Phe Tyr UUC UCC UAC UGC Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU His CUC CCC CAC CGC Leu Pro Arg CUA CCA СА CGA Gin CUG CG CAG CGG AUU ACU AAU AGU Asn Ser AUC Ile ACC AAC AGC Thr AUA ACA AAA AGA Met or Start ] Lys Arg AGG AUG ACG AAG G GUU GCU GAU GGU Asp GAC GUC GCC GGC G Val Ala Gly GUA GCA GAA GGA Glu GUG GCG GAG GGG What amino acid sequence will be generated, based on the following mRNA codon sequence? 5' AUG- UCU- UCG- UUA- UCC- UUG 3' met-arg-glu-arg-glu-arg met-ser-ser-leu-ser-leu met-glu-arg-arg-glu-leu met-ser-leu-ser-leu-ser First Base Third Base
- 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC Find start codon and stop codon UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCCRNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…
- READ INSTRUCTIONS WND COMPLETE MRNA CODON COLUMNFirst letter U U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine A AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG C Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC A CAA CAG Histidine Glutamine AAU AAC Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC GGU GGC AGA AGG Arginine GGA GGG AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC Arginine Serine Glycine Which mutation could result in the removal of a site for glycosylation or phosphorylation? DOAGUO AGUO AGUAG Third letter сFirst letter U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC CAA CAG AAU AAC Histidine Glutamine Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC GGU GGC AGA AGG Arginine GGA GGG Arginine Serine UOAGUO AGUOAGUCAG Glycine Which mutation would result in a conservative substitution with potentially serious consequences to the translation of the mRNA and synthesis of the protein? Third letter
- Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter1. The UAU and UAC codons in MRNA both specify What feature of the genetic code explains this? Second letter C UUU Phenyl- UUC alanine UAU UAC UCU Tyrosine UGU UGC Cysteine UCC Serine UCA UUA UUG UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan Leucine UCG CAU CÁC CUU CUC CUA CUG CGU CGC CCU CC CCA CCG Histidine Leucine CGA Arginine CGG Proline CAA CAG Glutamine AUU AUC Isoleucine A AUA AAU AAC Asparagine AGU ACU ACC ACA ACG AGC Serine Threonine AAA Methionine; start codon AGA AGG Arginine AUG AAG Lysine GUU GUC GAU Aspartic GAC acid GCU G GUA GUG GCC Alanine GCA GGA Glycine GGG GGU GGC Valine GCG GAA Glutamic GAG acid Chp 米 144 Third letter UCAG UCAGUCAGU CAG First letterIf the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter