Glutamine is an amino acid that has -CH₂-CH₂-CO-NH₂ as its R group. The R group of the amino acid isoleucine is -CH2-CH-(CH3)2. If these amino acids were in a globular protein in aqueous solution, where would they most likely be? O Both glutamine and isoleucine would be in the interior and on the exterior of the globular protein. O Glutamine would be in the interior, and isoleucine would be on the exterior of the globular protein. O There isn't enough information O Both glutamine and isoleucine would be on the exterior of the globular protein. O Isoleucine would be in the interior, and glutamine would be on the exterior of the globular protein.
Q: State what each of the following symbols stands for, be specific. 4. M 5. SD 6. α
A: Introduction There are various symbols are used in science. Scientific writing requires various…
Q: Label the lipophilic and hydrophilic region of each lipid molecule below. H₂C CH₂ H₂C-Ne H₂C H₂C. HO…
A: Lipids are integral component of the cell membrane. Their structure consists of a backbone made up…
Q: OH i ACP Suppose that a "snapshot" of FA synthase was taken and the above (drawn) intermediate…
A: The given reaction is from fatty acid biosynthesis that occurs in the cytoplasm. Fatty acid…
Q: What is the difference between starch and cellulose that makes one digestible and the other not…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: 4. A single base addition and a single base deletion approximately 15 bases apart in the mRNA…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: 1. Which types of RNA are transcribed by each RNA polymerase enzyme in eukaryotic cells?
A: Transcription is the synthesis of RNA from DNA that is the process of copying the information of a…
Q: What is the hydrodynamic stress of bioreactors when there are cell cultures?
A: Introduction A bioreactor is a vessel or manufactured device which gives biologically active…
Q: Some enzymes can catalyze a reaction involving NADH but cannot catalyze a reaction that uses NADPH.…
A: Since you have asked multiple questions we will solve the first question for you. If you want any…
Q: 3. Supra-secondary structures of proteins - supercoiled alpha- helix, Greek key, meander, interlock,…
A: Protein: The amino acids are arranged in a long chain and joined to one another by covalent peptide…
Q: Are there any negative allosteric regulators for glycogen phosphorylase?
A: Glycogenolysis is a process of breakdown of glycogen. Glycogen phosphorylase is an enzyme that…
Q: A mutation produces a tRNA with a new anticodon. Originally the anticodon was 5'-CCA-3'; the mutant…
A: Sometimes a codon that coded for some amino acid in a mRNA gets mutated to a stop codon. This type…
Q: Relate the molecular properties to physicochemical properties of the following Linoleic acid…
A: Lipids are one of the 4 major biomacromolecules. Lipids are insoluble in water and soluble in…
Q: Starch 1/2 English Muffin Fruit1 medium orange Milk 1 cup low-fat milk - Starch 1/2 c. Corn Protein-…
A: INTRODUCTION : Carbohydrates - Carbohydrates, or carbs(short name), are sugar molecules. Along with…
Q: 2. The two diagrams to the right il- lustrate plots of steady-state ki- netic studies to…
A: Phosphofructokinase-1 (PFK-1) is a rate limiting enzyme of the glycolytic pathway. PFK-1 catalyzes…
Q: Disruption of which process will have the greatest impact on the number of electron carriers used by…
A: Disruption of which process will have the greatest impact on the number of electron carriers used by…
Q: From which biosynthetic pathway is eugenol derived? O A. mevalonic acid OB. shikimic acid O C. mixed…
A: Eugenol is an allylbenzene derivative that is extracted from the essential oils from cloves. It is a…
Q: fredrickson's classification of hyperlipidemia (tubular format)
A: Familial hypercholesterolemia (FH) has an HLP2A (Frederickson type IIa) lipid profile. Fredrickson…
Q: Which of the following statements is/are TRUE about the Lock and Key model of enzyme-substrate…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: ATCase catalyzes the conversion of carbamoyl phosphate and aspartate into N-carbamoylaspartate, a…
A: Aspartate carbamoyltransferase is also known as aspartate transcarbamoylase or ATCase. It catalyzed…
Q: What is most correct about the following inhibition? Penicillin
A: The antibiotic penicillin irreversibly binds to and inhibits the activity of the transpeptidase…
Q: The biexponential equation for a two compartment model drug is C1,t = 50.0e-1.64t + 20.0e-0.147t.…
A: Pharmacokinetics: The study of the kinetics of drugs absorption, distribution, and elimination…
Q: (b) To the right is a diagram of the chemical groups in carboxymethyl-cellulose and DEAE-cellulose…
A: We are given the list and quantity of amino acid residues on the iso-1 cytochrome c and iso-2…
Q: The ΔG°' for hydrolysis of ATP to ADP + Pi is -30.5 kJ/mol. -Calculate the equilibrium constant for…
A: Standard Gibbs free energy change (∆G0') is the change in Gibbs free energy at standard conditions.
Q: 4) a) Draw the peptide ASYTL at pH 7 and 12. b) Draw a Titration Curve for this peptide. c) If this…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: phosphate. Contrast the properties of hexokinases I and IV with respect to oligomeric structure,…
A: Hexokinase is an enzyme that has the ability to transfer inorganic phosphate group from ATP to the…
Q: How do R groups constrain the potential conformations of a protein?
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: Which of the following statements is CORRECT? A) Hexokinase IV is allosterically inhibited by…
A: Enzyme plays an important role in all the metabolic activities in our body. They themselves remain…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…
A: AP site is Apurinic site or Abase site at which nitrogen base is lost from the nucleotide of DNA and…
Q: Carbohydrates and proteins each generate 4kcal/g when oxidized in the bomb calorimeter but in…
A: Cellular respiration Cellular respiration is a collection of three metabolic pathways that generate…
Q: The following scheme shows how acetylcholine esterase (AChE) enzyme hydrolyzes acetylcholine (ACh).…
A: A cholinergic enzyme called acetylcholinesterase (AChE) is mainly present in postsynaptic…
Q: The beta-pleated sheets are stabilized by hydrogen bonds among adjacent regions of the peptide…
A: Introduction Protein is the most abundant macromolecule in our body. proteins are made up of carbon,…
Q: INFLUENCE OF FREE ACID tt #1 tt #2 tt #3 tt #4 CONDITION 4 mL 0.2% HCI + 1 mL starch paste + 1 drop…
A: Effect of saliva on starch: Saliva contains the digesting enzyme amylase, which breaks down starch.…
Q: There are some cells in our bodies (stem cells) that are able to form new structures even in adults.…
A: Stem cells are undifferentiated cells In our body that can turn into any specific cells, as per the…
Q: At a substrate concentration that is much greater than the KM for the reaction, which statement is…
A: The velocity of an enzyme catalyzed reaction is given by: V=Vmax×SKM+SWhere,V= velocity of the…
Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: Phospholipids are compound lipids composed of fatty acid, alcohol, nitrogen containing molecules,…
Q: For each of the structures listed below identify the class of lipids to which it belongs (fatty acid…
A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…
Q: Calculate the resulting equilibrium concentrations of all four species. Express your answers to four…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium, the concentration of reactants and…
Q: Recall that vmax is achieved only at high substrate concentrations. Do you predict that vmax will…
A: Enzyme kinetics is the study of enzyme reactions rates and the conditions which affect them. Enzyme…
Q: The first reaction in glycolysis is the phosphorylation of glucose to form glucose 6-phosphate: P: +…
A: Given Values: ∆G°=13.8 kJ/mol or 13800 J/mol[Pi] = 5 mM[Glucose] = 5 mM
Q: How many reduced molecules (NADH, FADH2, NADPH) will be generated by converting lineoleic acid…
A: The fats are stored in eukaryotes as triglycerides that are broken down using the enzyme Lipase to…
Q: Which factor does NOT represent a barrier that prevents a reaction from taking place? substrate…
A: Reaction is a process by which a set of molecules is transformed to another. Many factors effect the…
Q: Explain IN DETAIL the process of glycolysis. Include the overall equation, location products,…
A: Introduction Glycolysis is a process by which glucose breaks down to produce pyruvate and energy.…
Q: What will be the result for each qualitative test if the intact casein contains the following…
A: Proteins are folded peptides. Peptides are made up of amino acid residues linked via a peptide bond.…
Q: Why carbon C-2 and C-5 are mark? why not just ona carbon is marked since just one carbon was marked…
A: Gluconeogenesis is the synthesis of glucose molecules from non-carbohydrate sources such as…
Q: Which protein structural features are apparent in the protein structure below? Select all that apply…
A: Different bonds contribute to protein folding. These bonds are hydrogen bonds, hydrophobic bonds,…
Q: When doing automated sequencing, on the other hand, all 4 dideoxynucleotides are added to the same…
A: The genetic information is encoded in the sequence of DNA that is the genetic material. The Sanger…
Q: receptor/s b. the energy source c. if there is signal peptide cleavage or none E. Mitochondrion…
A: Major proportion of the mitochondrial proteins are encoded by the nuclear genes. These proteins are…
Q: First image contains the respective absorbance readings of the samples specified in the 96-well…
A: Protein concentration of unknown sample could be calculated by plotting the graph for standard…
Q: What is one technique or property of a protein that you could use to monitor the fractions so you…
A: In column chromatography, there is a stationary phase and the mobile phase. The stationary phase…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Which of the following amino acids would you expect to find more often near the center of a folded globular protein? Which ones would you expect to find more often exposed to the outside? explain your answers. Ser, Ser-p (a Ser residue that is phosphorylated), Leu, Lys, Gln, His, Phe, Val, Ile, Met, Cys–S–S–Cys (two cysteines that are disulfide- bonded), and Glu. Where would you expect to find the most N-terminal amino acid and the most C-terminal amino acid?Amino acids project from each polypeptide backbone in a β-sheet in an alternating fashion (oneabove the plane and the next below the plane – see Fig 3.8B). Consider the following proteinsequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg-Leu-Lys-Ile-Arg-Phe-Glu.a. Is there a pattern to these amino acids? If so, what is it? b. What does this sequence of amino acids mean for the hydrophobicity/hydrophilicity of theresulting β-sheet? c. Can you make a prediction about how the β-sheet will be arranged in higher levels of protein structure? If so, what prediction would you make?The R group or side chain of the amino acid serine is -CH2-OH. The R group or side chain of the amino acid leucine is -CH2-CH-(CH3)2. Where would you expect to find these amino acids in a globular protein in aqueous solution ?A) Both serine and leucine would be on the exterior of the globular protein. B) Both serine and leucine would be in the interior and on the exterior of the globular protein. C) Serine would be in the interior, and leucine would be on the exterior of the globular protein. D) Both serine and leucine would be in the interior of the globular protein. E) Leucine would be in the interior, and serine would be on the exterior of the globular protein.
- A particular amino acid contains a -CH2NH3+ group. Is this amino acid more likely to be found on the inside or outside of the folded protein? Briefly explain.Which of the following amino acids is most likely to be found on the outside of a soluble protein, and which of them is more likely to be found on the inside? Explain each answer. (Hint: Consider the effect of the amino acidside chain in each case and that the protein is folded up into its globular form.)(a) Valine (b) Aspartate(c) Histidine (d) AlanineIf an oligosaccharide is attached to a protein via an O-glycosidic linkage which amino acid residue(s) are likely to be involved? O Glutamine O Serine O Histidine O Threonine O Both (b) and (d)
- For the protein given in the attached picture: Write the name of these 5 amino acids corresponding to their abbreviation of 3 letters. Describe precisely how the functional groups in the amino acids are involved in bonding between two successive amino acids in the protein.If the protein you are studying is known to bind the molecule shown below, what types of amino acids would you expect to be forming interactions at each of the numbered positions. Explain your reasoning for your choices 2 0 N* H- H H. 4. 3. 1,Identify the following statements as descriptive of the secondary, tertiary, or quaternary structure of a protein. What types of interactions stabilize each type of structure?(a) The polypeptide chain has a number of bends and twists, resulting in a compact structure.(b) The polypeptide backbone forms a right-handed coil.(c) The four polypeptide chains are arranged in a spherical shape.
- Which of the following amino acids are more likely to be on the interior of the protein? And which are more likely to be exposed to the surface? L I D E W A V K H M Q YConsider the following two peptides: I. N-Pro-Pro - Glu - Glu - Tyr - His - Cys - Ala - Glu - Gln - Lys - Leu - Ser - Ser - Phe-Leu- Thr - C II. N-Pro-Pro - Lys - Arg - Gly - Tyr - His - Gly - Glu - Asp - Glu - Asp - Glu - Ser - Gly-Phe- Tyr-C Give three reasons why_peptide I is more likely to form an alpha helix in aqueous solution at pH 7.0. Your reasons may include why_peptide Il is less likely to form an alpha helixWhich of the following amino acids is most likely to be found on the outside of a soluble protein? Which is more likely to be found on the inside? Explain each answer. (Hint: Consider the effect of the amino acid side chain in each case and that the protein is folded up into its globularform.)(a) Leucine (b) Glutamate(c) Phenylalanine (d) Glutamine