Give typing answer with explanation and conclusion 5. The following diagram represents DNA that is part of the RNA coding sequence of a transcription unit. The bottom strand is the template strand. Give the sequence found on the RNA molecule transcribed from this DNA & identify the 5ʹ and 3ʹ ends of the RNA. 5′–ATAGGCGATGCCA–3′ 3′–TATCCGCTACGGT–5′ ← Template strand

Give typing answer with explanation and conclusion 5. The following diagram represents DNA that is part of the RNA coding sequence of a transcription unit. The bottom strand is the template strand. Give the sequence found on the RNA molecule transcribed from this DNA & identify the 5ʹ and 3ʹ ends of the RNA. 5′–ATAGGCGATGCCA–3′ 3′–TATCCGCTACGGT–5′ ← Template strand

Name: Give typing answer with explanation and conclusion 5. The following di
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Give typing answer with explanation and conclusion 5. The following diagram represents DNA that is part of the RNA coding sequence of a transcription unit. The bottom strand is the template strand. Give the sequence found on the RNA molecule transcri

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
Please answer both question.its all a one question.otherwise I will give downvote. Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose that the 3/ → 5/ is the template strand: 3/-TAC-GAC-CGT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-GAT-ACT-5/ 5-/ATG-CTG- GCA-ACC-GAA-GAC-ACA-TCC-ATA-TGG-CTA-TGA-3/ 1- Write down the mRNA transcript with direction of ends of the strand? 2- Construct the resulted polypeptide chain from translation of the mRNA above based on the following codons translation below AUG: Methionine GCA: Alanine ACC: Threonine UGA: write its name GAA: Glutamic acid GAC: Aspartic acid CUG: Leucine ACA: Threonine UCC: Serine AUA: Isoleucine UGG: Tryptophan CUA: Leucine
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
Template strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5' and 3' end designations. B. Write the amino acid sequence coded by this mRNA. The start codon is the first codon in the sequence that codes for Met. First position (5'-end) U < G บบบ UUC phe UUA UUG CUU Couleu CUC Coc CUA CUG AUU AUG AUC ile GUU GUC GUA GUG Second position C UCU UCC UCA UCG val CCU co CCC CCA 000 CCG ACU ACC ACC AUA ACA thr AUA ACA AUG met ACG GCU GCC ser GCA GCG pro ala UAU ORD tyr UAC UAA Stop UAG Stop CAU CAC CAA CAG - AAU AAC www AAA 10 asn AAG 7 his GAU GAC GAA GAG gin }| lys asp glu UGU UGC cys UGA Stop UGG trp CGU C00 CGC CGA 000 CGG AGU AGC ACA AGA AGG GGU GGC GGA GGG Initiation Termination arg ser arg gly DUAL SUAU DUAU DUAG Third position (3-end)
Sources of Variability 1. If a point mutation occurred so that adenine was changed to thymine in the amino acid triplet code CTA, what would the resulting amino acid be? 3. What is the complementary DNA code for the following base sequence (from a section of DNA)? ATG C C C G G C CT TATTTTCTACA TGGT b. What is the complementary mRNA code? c. What is the tRNA code for this sequence? ACTT
First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
Using the provided coding strand below: 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the mRNAstrand for the coding strand above. Type your answer in the box below. Use two dash lines in between the 5 and your first base, and two dash line between your last base and before 3' (follow formatting above). What is your Start codon? What is your Stop codon? 5-AUGGCCGGGCCAAUAGAAUAG-3 AUGGCCGGGCCAAUAGAAUAG
From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed