Q: Provide what is being asked for. Show all relevant calculations and summarize your answers in the…
A: Fatty acid oxidation is the aerobic breakdown of a fatty acid into acetyl-CoA units in the…
Q: The temperature at which a lipid bilayer shifts from a fluid state to a crystalline gel is called…
A: Lipids are defined as a diverse group of naturally occurring molecules that are insoluble in water…
Q: E. coli strains diploid for the lac region were constructed by introducing a plasmid carrying the…
A: ANSWER;- I- mutation- repressor is unable to bind to the operator region. If there is no other…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: What happened to the angry clipbird population in the East over the three seasons? Explain why you…
A: Natural selection acts on genetic variation within a population to produce evolution. Natural…
Q: Question 41 The model describes the cell membrane as an assortment of integral proteins suspended…
A: Introduction:- The cell membrane, also known as the plasma membrane, is a thin membrane that…
Q: Discuss some issues raised involving the biosafety and ecological implications of the field-testing…
A: Genetic modification and biotechnology are two terms that are used interchangeably to describe a…
Q: Zoology experiment: The Predator-prey Interactions Between Zebrafish and Daphnia 1. Six 1-L beakers…
A:
Q: Larvae and pupae per Bt plant 100 Ö TOKH company -- Mosaic, Cry1Ac plant --- Mosaic, Cry1C plant --…
A: Mosaic treatment of plants and density of moths after treatment.
Q: Describe the step by step method of preparing culture media in microbiology.
A: Culture media are the media or the substrate used to grow microorganisms. There are different types…
Q: In which of the following phases does this specific arrangement of chromosomes occur? No answer O…
A: 25) The given arrangements of the chromosome shows the stage in which the genetic material of the…
Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…
A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…
Q: Match lipid descriptions in column A with the phospholipid type in column B H is attached to the…
A: 1. H is attached to the phosphate group bound to C3 of glycerol backbone --> D.…
Q: What are the protein/enzyme requirements during initiation, elongation, termination of DNA…
A: In this question we have to describe about Central dogma. See full answer in step 2
Q: > The heat on your finger in triggers a/an_____ your skin. The activate something like the muscle,…
A: The heat on your finger triggers a/an stimulus in your skin. The interneuron activate something like…
Q: Sarah Wilson 5 days ago What are the biologically important types of lipids?
A: A lipid is a fabric this is insoluble in water but soluble in alcohol, ether, and chloroform in…
Q: Decreased prod A) Estradiol B) Inhibin OC) Progesteron D) Prolactin OE) Prostate-spe
A: FSH or Follicle stimulating hormone maintains the correct level of testosterone hormone. When the…
Q: What is the purpose of photosynthesis? * O to convert sunlight into energy. O to convert ADP into…
A: Photosynthesis is the process in plants in which plants prepare food using carbon dioxide and water…
Q: Globular cells are said to be spherical. When slightly flattened, they are disc-shaped. Squamous…
A: Ques : What is the shape of the cartilage cell(1), bone cell(2), and cardiac muscle(3) specimens?…
Q: A perfect flower is one in which both ________ and ______________ are present.
A: Flower The flower is defined as the reproductive part of the plant which contains male and female…
Q: Please answer fast Explain how the behavioral and/or physiological response of an organism is…
A: The behavioral and physiological response of an organism is important for its survival. The ability…
Q: Promoters and enhancers are important regulatory sequences for many eukaryotic protein- genes. Which…
A: Transcription is the process of forming transcripts or RNA from DNA through complementary base…
Q: F1 mice targeted using CRISPR/Cas9 and an HDR DNA fragment is the first choice when modeling a.…
A: During replication, there will be a tiny number of mistakes in the sequence every time this happens.…
Q: 1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the…
A: 1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the…
Q: A correlation between two variables implies that ... one variable may or may not directly affect the…
A: ANSWER;-d) One variable directly affects the other variable. Explain;- Connection is a factual…
Q: Lipids may originate through carbocation-based condensation of thioesters or by carbanion-based…
A: To describe about formation of lipid mechanism. See full answer in steps below.
Q: How much of each ingredient (in kg) should be used in order to satisfy the protein requirement of…
A: CP, i.e., Crude Protein is a measure of the amount of protein in a feed. The CP of soybean meal is…
Q: Label the cell membrane for each figure. Give a short description (size and cell shape) for each of…
A: The above experiment is related to osmosis and the effect of solutions with different tonicity.…
Q: 1. Why is that there are no more than 5 or 6 trophic levels in a community? 2. Why do we need to…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question for…
Q: Explain how mismatch repair fixes incorrectly matched base pairs.
A: Introduction A base pair is a link between two nitrogenous bases in DNA that helps keep two…
Q: gene silencing of eukaryotic genes. What is the purpose of this mechanism and how it works?
A: Gene silencing in eukaryotic genes- Gene silencing is the mechanism by which cells shut down…
Q: auditory nerve
A: Auditory nerves and the brain Nerve impulses are transmitted from the ear to the brain via the…
Q: What does the word "patch" denote in a patch-clamp setup? Shape of a glass micropipette Open tip of…
A: Patch clamp technology is a method used in electrophysiology to measure the ionic current. This…
Q: Water strider is a representative specimen of Hemiptera, which one is NOT their trait? a. The wings…
A: Hemiptera is an order of insects, comprising over 80,000 species within groups such as the cicadas,…
Q: A ADF F D Match the structure given with the name. Acetyl coenzyme A pyruvate Complex V of the…
A: The given structures in the figure are the structures involved in cellular respiration for the…
Q: Match the description on the left with the correct term on the right. Some answers may not be used.…
A: Match the correct term on the right to the correct description on the left.
Q: You decided to change your diet. You want to lose weight without making your physique bulky, which…
A: Weight loss is an internal process that is possible through a healthy diet and by performing intense…
Q: "What property of membranes allows interactions to take place within the membrane, including the…
A: A biologic barrier which divides the interior of a cell from its exterior environment is called as…
Q: Which of the following statements are characteristics of the aerobic respiration method of making…
A: Aerobic respiration is a chemical process in which oxygen is used to make energy from carbohydrates…
Q: Describe the type and strength of the relationship between number of chicks and predators. positive,…
A: Correlation coefficients are numerical measurement that determines the strength of a relationship…
Q: Based on the results of the experiment shown below, can you determine the distance between the genes…
A: The distance between two genes can be determined by determining the percentage of new recombinations…
Q: What color of light results from the addition of cyan light and red light? green blue white magenta
A: Green, blue and red are primary colours. When these colours are mixed in different proportions new…
Q: Explain in two to three sentences, how ATP stores and releases energy.
A: ATP stores energy- The chemical ATP (adenosine triphosphate) is found in all living things. When a…
Q: What part do Balanus use to maintain its position in its natural environment? a. Podia b. Suckers…
A: Balanus It refers to the genus of barnacles which belongs to Balanidae family. Their bodies are…
Q: I. MULTIPLE CHOICE DIRECTIONS: Encircle the letter that corresponds to the correct answer. Avoid…
A: We are allowed to do upto 3 MCQs. Please repost the undone question again. Thank you for choosing…
Q: acid base balance
A: Acid is a substance that is capable of donating protons. Base is a substance that accepts the…
Q: 1) Blood pressure is measured with a 2) What is the average normal blood pressure for adults? Label…
A: Blood pressure is measured with a sphygmomanometer. Average normal blood pressure of an adult is…
Q: Examine closely the dissected 5 different flowers for these characteristics based on: -…
A: Characteristics of given specimens :-
Q: 87. A patient develops increased thirst and urinary frequency shortly after head trauma. If ADH…
A: Introduction:- The hormone antidiuretic hormone (ADH) aids the kidneys in controlling the amount of…
Q: Two-dimensional normal phase ascending TLC is used for the following reasons: for further separation…
A: Introduction TLC or Two-dimensional chromatography is a type of chromatographic technique which is…
Step by step
Solved in 2 steps
- In normal plants, the probability that an offspring of a heterozygous parent is heterozygous is 0.5. If the survival of heterozygous offspring differs from that of homozygous offspring, the probability that a surviving offspring is heterozygous may not be equal to 0.5. For the following values of the probability, write a discrete-time dynamical system for the fraction of heterozygous offspring over time, find the solution, and compute the fraction that will be heterozygous after ten generations. How does this compare with the fraction for a normal plant? The probability that an offspring is heterozygous is 0.6.A gardener grows two different colors of apples under exactly the same environmental conditions. Red apples have a heritability of 0.14 for the value of apple weight, and green apples have a heritability of 0.41 for the value of apple weight. The gardener plotted the number of apples present at each weight. Which graph would you hypothesize represents the red apples? Number of apples Weight GRAPH A Number of apples Weight GRAPH B O Graph A O Graph B There is not enough information to make a hypothesis.A species of butterfly shows variation in the length of the antennae. You measure antennae in a butterfly population and find the mean to be 15 mm. You calculate a heritability of antennae length to be 1 (h2 = 1). %3D That summer, there is a severe drought. Many of the butterflies die and only a few survive to reproduce. The surviving butterflies have a mean antennae length of 17 mm. a) What is the predicted mean limb-length of the offspring of the surviving butterflies? [ Select ] b) What type of selection was acting on antennae length in these butterflies? [ Select ] c) Five years later, you go back and measure antennae length in this butterfly population again. Every butterfly in the population has antennae measuring 16 mm. What is the heritability of antennae length in this population now? [Select ]
- Solve the following Punnett Square questions. Write your answer in the form of a percent. 2. In a certain species of plant, the color purple (P) is dominant to the color white (p). According to the Punnett Square, what is the probability of an offspring being white? % Parent (PP) Pp Pp Parent (pp) Pp PpPOLLEN ud INBRED PLANT FIRST YEAR DETASSELED DETASSELED BXA -SINGLE-CROSS SEED INBRED PLANT POLLEN FROM CXD DETASSELED ACXO SINGLE-CROSS SEED SECOND YEAR Fucke SINGLE-CROSS PLANT (BXA) INBRED PLANT C (B x A)x(CxD) DOUBLE-CROSS SEED FOR COMMERCIAL PLANTING a INBRED PLANT D SINGLE-CROSS PLANT (CXD) In the early 1900s, plant breeders showed that crossing individuals from two different favorable inbred varieties produced hybrid offspring often more vigorous and having more desirable traits than offspring produced from inbreeding. This phenomenon, known as heterosis, led to tremendous increases in corn production in the United States. In 1931, 0.1 percent of the corn planted was hybrid corn, resulting in an average yield of 24.5 bushels per acre. In 1992, almost all corn planted in the United States was hybrid corn, resulting in an average yield of 135 bushels per acre. Study the figure at the bottom of the page, which shows the current method for producing hybrid corn. Explain the…In a certain species of plants, violet flower color (V) is dominant over white flower color (v). If p = 0.4 and q = 0.6 in a population of 500 plants, II.heterozygous (Vv):
- The mean of plant height from two rice plants (P1 and P2) and their progeny (F1 and F2) and a backcross generation (P1 x F1) are shown below. Population Mean (in) P1 34.1 P2 65.2 F1 44.1 F2 46.2 BC1 39.6 Explain the possible reasons for the observed differences in the sample means. Account for the differences in the sample means of P1 and P2. Similarly, account for the differences in the sample means of the F1 and F2. Compare the difference in the parental generations with that in the filial generations.> NEXT A BOOKMARK Question 23/28 According to the probability of the pea plant offspring in chart 2, what percentage of the offspring will be yellow in color? Use the diagrams below to answer the questions that follow. 23 Pea Plants Chart 1 A 5% Punnett Square B) 19% с) 30% Aa Aa D 25% Aa A a E) 75% Chart 2 AaBb x AaBb AB Ab aB ab Key AB AABB AABB Ab AABB AABB AaBb AA - Green BB - Smooth AAbb AaBb Aabb AABB AaBb aa - Yellow aB AaBb aaBB aaBb bb - Rough ab Aabb aaBb aabbIn eggplants, fruit color is due to two alleles with the Purple allele (CP) incompletely dominant over White (CW). Plants that are heterozygous for this allele produce light violet colored fruit. A biologist surveys a field of eggplants that has been left alone for several years, allowing the eggplants to reproduce and grow without harvesting or disturbance. She finds that 600 of the plants make purple fruits, 200 make light violet fruits, and 200 produce white fruits. Calculate p (fraction of CPalleles in the populations): Calculate q (fraction of CWalleles in the populations): If this population of plants is at Hardy-Weinberg Equilibrium, what fractions (round to two decimal places) of the next generation of egg plants will produce Purple, White, and Violet fruits? Purple: Violet: White: If the frequency of white alleles was actually much higher in next generation than expected, and continued to increase in future generations, and the population stays relatively large, what type of…
- Figure 19-16 shows the results of a QTL fine-mapping experiment. Which gene would be implicated as controlling fruit weight if the mean fruit weight for each linewas as follows?Line Fruit weight (g)1 181.42 169.33 170.74 171.25 171.46 182.27 180.68 180.79 181.810 169.3What phenotypic ratio would you expect to see if you self-fertilized a plant that was heterozygous for two traits? 9:3:3:1 3:1 All offspring would have the same phenotype It is impossible to predict this based on the information givenQuestion 1 Review Concept 14.1 Match the term and its description. Each term can only be used once. a heritable feature that varies among individuals (such as flower | Choose color) each variant for a character | Choose ) the true-breeding parents [ Choose the hybrid offspring of the P generation |Choose )