Answered: Describe an exercise routine that would…

Describe an exercise routine that would build up each of the following groups of muscles: anterior arm, posterior arm, anterior forearm, anterior thigh, posterior leg, and abdomen. asap please.

Comprehensive Medical Terminology

4th Edition

ISBN:9781133478850

Author:Jones

Publisher:Jones

Chapter7: Muscles And Joints

Section: Chapter Questions

Problem C1CRE

See similar textbooks

Related questions

Q: E. A medical facility received 100.0g of Fluorine-18. After 8 hours, there was only 6.25g left. What…

Q: Which of the below explains why trisomy is better tolerated in humans than monosomy? (Select all…

A: 1.  (a)  To Determine: If the…

Q: Describe the importance of dietary sugars and lipids. In your answer, discuss in detail the impact…

A: Introduction A macromolecule, such as a protein or nucleic acid, is a very big molecule crucial to…

Q: How does the digestive system of a nematode or annelid differ from that of a flatworm? In what ways…

A: Animals are eukaryotic structure, containing numerous cells , with absence of cell wall . Phylum…

Q: For questions 1-3, suppose that in generation 0, the frequency of allele A1 in a population of…

A: Introduction The relative frequency of an allele (gene variant) at a certain locus in a population…

Q: Besides cloning vectors, there are also expression vectors. What is the main differenc between these…

A: cloning vector is a small piece of DNA that can be inserted into organism for cloning purpose.…

Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…

A: Many people agree that one of the 20th century's most significant contributions to molecular biology…

Q: Describe the steps of DNA replication. ( keep it short please:) )

A: Why Replicate DNA? The DNA is the genetic material that is the defines in the every cell. Before the…

Q: Which statement best describes the reason maternal recessive CYP1A1 polymorphisms of CYP1A1 decrease…

A: Answer: ...It increases the metabolism of nicotine. ...It increases the metabolism of PAHs.

Q: Which substance is needed for collagen synthesis ? vitamin D phosphorus…

A: Some vitamins are water soluble such as vitamin B complex,Vitamin C. They can excrete out of body…

Q: 3. Why does intercellular spaces are absent in sclerenchyma tissues?

A: Tissue is a group of cells. These cells work together to perform specific function.

Q: Describe the steps of DNA replication. (3 sentences please)

A: Introduction: DNA replication is the process of duplicating DNA. Replication is carried out through…

Q: QUESTION 37 A reservoir is O an environment that may contain various pathogenic microbes. O a living…

A: Introduction :- All living and non-living objects that occur naturally, or in this example, without…

Q: The light dependent reactions of photosynthesis serve to __________ while the light independent…

A: Photosynthesis is a metabolic process by which green plants (that possess chlorophyll, which is…

Q: What process might give rise to this population of cells?

A: These blood cells are the Subtypes of granulocytes, having irregular shape, with multilobed…

Q: The haploid number of chromosomes in a cell of a grasshopper is 18. How many chromosomes are in a…

A: A chromosome is a lengthy DNA molecule that contains all or a portion of an organism's genetic code.…

Q: 7.13 In rabbits, the dominant allele C is required for colored fur; the recessive allele c makes the…

A: Introduction :- The relationship between two genetic variants is referred to as dominant. Each gene…

Q: II. Cultural characteristics of yeasts. Below is the colony diameter for each yeast culture grown on…

A: Yeasts are single-celled, eukaryotic microorganisms that belong to the fungal kingdom. There are…

Q: In what type of fluid would you expect to see these cells? What are these cells called?\

A: The cells are the structural and functional unit of living organisms. They perform specific…

Q: Which of the following is FALSE about fruit? A. Mature ovary B. Protect seeds and aid in dispersal…

A: Introduction : Angiosperms are flowering plants that produce fruits with seeds inside of them. They…

Q: Describe the phototransduction cycle of photoreceptors?

A: Phototransduction is a series of sensory transduction processes of eye. It involves conversion of…

Q: A given substance would require active transport across a lipid bilayer into a cell if... (choose…

Q: Gradient ascent search is prone to local optima just like hill climbing. Describe how you might…

A: In numerical analysis, hill climbing is a mathematical optimization technique that belongs to the…

Q: How many ATPs are there in this triglyceride? Showing NADH and FADH2 calculations and steps

A: Triglycerides broken down into glycerol and three fatty acids containing 12, 16 and 14 carbon atom…

Q: Genetically modified foods (GM foods) are products produced from organisms that have had genetic…

A: Crops that have had their DNA altered through genetic engineering are referred to as genetically…

Q: to answer the next A diet rich in lycopene, a nutrient found in tomatoes, can reduce the risk of…

Q: What are the forces that affect muscle strength?

A: Introduction: One of the three important muscle tissues in the human body is found in the skeleton.…

Q: 6. B cells are most important in the _______ immunity type of _______ immunity.? .A.Cellular;…

A: Introduction :- The lymphocyte class known as B cells is in charge of the humoral immunity portion…

Q: 9. which of the following is an example of quantitive data? A)the freshman class of the students…

A: Introduction:- data represent the various types of discrete values which provides information about…

Q: 1. Consider a cell with surface area 2.5 x 102 mm², initial water potential of -0.3MPa and membrane…

A: When the temperature and the pressure are held constant then the potential energy of the water to…

Q: features of adaptation” may influence program design for a given population.

A: What Features of adaptation in animals leads to influence the population?

Q: heightened responses to ethanol, and ken&barbie (kb) lack external genitalia. [These are real genes…

A: The technique of pinpointing a gene's position on a chromosome is known as gene mapping. The most…

Q: An increase in epinephrine results in: a. An increase activity of insulin. b. An…

A: In emergency or stress condition (Like injury, pain, fear, accident, etc.), impulses from…

Q: pZERO®-1. Some vectors are designed specifically for TA cloning while some are not. What is TA…

A: A vector is a living organism that can transmits an infectious agent from an infected animal to…

Q: Describe the feeding biology of centipedes, spiders, mites and beetles. Compare and contrast these…

A: We know that centipedes, spiders, mites, and beetles belong to the phylum Arthropoda and which is…

Q: 16. Nitrogen bases pair with bases that are O available identical complimentary O opposite

A: Introduction : The centromere is the region of the chromosome that attaches to a spindle fibre at…

Q: IV V Fig. 1 Disease pedigree in one family. Five generations I, II, III, IV and V are shown. Females…

A: Pedigree gives a major insight about the type of inheritance pattern either autosomal recessive or…

Q: Is a chromosomes a one half of a newly replicated eukaryotic chromosome

A: The eukaryotic chromosomes consist of a DNA-protein complex that is organized in a compact manner…

Q: Polymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This technique had indeed…

A: The annealing temperature is the temperature at which the primers bind to the denatured DNA strands.…

Q: Examples of ionizing radiation that are able to damage DNA and kill bacteria are Microwaves and…

A: Bacteria Or microbial pathogens can be killed by gamma ray, Ultraviolet rays, Radiowaves of…

Q: After cloning is carried out to insert a foreign gene into BL21(DE3), you would like to confirm the…

A: The cloning is the technique which is described as the processes used to create an exact genetic…

Q: Besides plants, animals could also be genetically engineered. Describe TWO (2) transgenic fishes…

A: Transgenic animals are animals that carry a foreign gene. These genes are deliberately introduced…

Q: Homologous chromosomes come together and line up along their entire lengths A. in meiosis in…

A: Meiosis is a unique form of germ cell division in sexually reproducing animals that results in the…

Q: 25) In most social insects, females (workers and queens) develop from fertilized eggs and are…

A: The conflict of interest between the queen and her worker daughters over the generation of…

Q: 3. For a trait caused by a mitochondrial gene variant, there may be females that can transmit…

A: She displays heteroplasmy for its trait and she is the product of somatic mutataion. Heteroplasmy…

Q: Which of the following components found in the bone matrix make bone hard? calcium…

A: The skeletal system gives stability to the body. It is responsible for locomotion of the organisms.

Q: Question 3 Part 1: Biological invasions have proliferated in recent decades because of increased…

A: An organism that has been introduced and has overpopulated and harmed its new environment is said to…

Q: 5'-GUCAGCAU-3' but i need help understanding why is it.

A: Introduction In the majority of species, genetic information is stored in DNA. Each human cell has…

Q: On the diagram of the interneuron, drag and drop the terms dendrites, cell body, axon and synaptic…

A: The diagram in the question shows a nerve cell or neuron. The labeling will be as follows. The top…

Q: .4 Indicate whether the following statements are true or false. For each FALSE answer please…

A: Introduction : In order to absorb nutrients, complex food particles must be broken down into…

Concept explainers

Muscle Action

A change in the body or a bodily organ as a result of its functioning is referred to as an action. Muscle action can be defined as the specific movement of a bodily part generated by the contraction of a muscle. The muscle proteins actin and myosin are the important contractile proteins involved in muscle action. Muscle contraction, in addition to movement, serves several other important functions in the body, including posture, heat generation, and joint stability. Muscle contraction maintains posture, which includes standing and sitting.

Question

Describe an exercise routine that would build up each of the following groups of muscles: anterior arm, posterior arm, anterior forearm, anterior thigh, posterior leg, and abdomen.

asap please.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Order the following muscles from most muscle fibers per motor unit to least: biceps brachii, gluteus maximus, orbicularis oculi. Group of answer choices Orbicularis oculi, gluteus maximus, biceps brachii Gluteus maximus, biceps brachii, orbicularis oculi Orbicularis oculi, biceps brachii, gluteus maximus (no answer)
Explain the following terms describing muscles in not more than 1-2 lines. Examples are not required. origin insertion tendon belly raphe aponeurosis
Write the names of the muscles which will be stretched during the following movements? Shoulder Flexion and Extension, Elbow Flexion and Extension, Hip Flexion and Extension, Knees Flexion and Extension, Dorsiflexion and Plantar Flexion.
Describe the following terms Muscle Insertion Agonist Antagonist Synergist Abductor
Several criteria were given for the naming of muscles. Match the muscle names (column B) to the criteria (column A). Note that more than one muscle may fit the criterion in some cases Column A action of the muscle 2 shape of the muscle 3 location of the origin and/or insertion of the muscle 4 number of origins 5 location of the muscle relative to a bone or body region 6 direction in which the muscle fibers run relative to some imaginary line 7 relative size of the muscle Column B abdominis transversus biceps brachiideltoid erector spinaeexternal intercostalsflexor digitorum superficialis pectoralis majorrectus abdominis
During a Physical Education class, you ask your students to perform a standing vertical jump. Identify the type of muscle contraction involved in the jump and describe the movement patterns of the concentric and eccentric phases. Outline the agonists, antagonists and synergist muscles, which contribute to maximum jump height. Identify the major lower body joints and joint movements, which contribute to the concentric phase of the jump.
The hamstring muscles in cats (and humans) are composed of the muscles. Select 3 options: rectus femoris biceps femoris semimenbranosus gastrocnemius vastus intermedius semitendinosus
Muscle Shapes Please label the following muscle types. In the numbers below the photo, list a muscle who is built in that particular muscular shape. Circular 2.convergent SumulAipenhate 4Parallel 7Cnipenate 3Bipennate 5. 1. m Outh 2. pectovalis major 6. 3. 7. 4. Defining Muscle Terms Define the following terms in your own words. AL Isometric: Isotonic: Prime mover Antagonist:
Muscles work in groups when they perform multifaceted movements. Write the anatomical term that describes the muscle of a compartment that performs the following action. 1. M uscle that is opposing an action 2. Muscle that stabilizes the origin of a prime mover 3. Small muscle that aids prime mover 4. Prime mover. Muscle that is causing an action
Describe each of the below muscle actions and list at least one muscle that creates the action.Lower Extremity Muscle Actions: · Knee flexion · Knee extension · Knee medial rotation · Knee lateral rotation · Dorsiflexion · Plantarflexion · Foot inversion · Foot eversion · Foot digits flexion · Foot digits extension· Hip flexion · Hip extension · Hip medial rotation · Hip lateral rotation · Hip abduction · Hip adduction *PLEASE ANSWER ALL IF POSSIBLE.
Chose two of the major muscles or muscle groups. Using correct terminology and with reference to insertion and origin points, describe how the muscle originates proximally and inserts distally to cause a movement at the joints that are crossed What types of movement does this create, and what are some actions that involve the use of these movements? Give another example of when the movement would be used during physical activity, sports and/or everyday life. (please help!!)
1) Based on the 6 fitball stretches [pelvis Tilt, side to side, backbend, fwd bend, childs pose, and low lunge], write a paragraph about 3 fitball stretches. Reference the anatomical names of the muscles you are stretching, (according to the muscular chart) and how this will serve your daily needs e.g. workouts, posture, work duties, etc.