On the diagram of the interneuron, drag and drop the terms dendrites, cell body, axon and synaptic terminal to the appropriate structures. Beside each label, Irag and drop the function of that structure. We a
Q: interpret constructively the given iris scatterplot below
A: The iris is the colored part of the human eye. Muscles in our iris control our pupil that is the…
Q: Can body composition be directly measured? Why or why not?
A: Body composition gives an overall health evaluation and is critical in determining an individual's…
Q: Baltimore Oriole Black-backed Oriole Female Male Kondo, Baker, & Omland 2004 2B. Based on the…
A: The Baltimore oriole is a small icterid blackbird that is common in eastern North America as a…
Q: Order: 1 L of 0.9% NS with 40,000 units of heparin over 24 hours. Calculate the rate in mL/h.
A: Heparin is used to prevent or treat certain blood vessel, heart, and lung conditions. Heparin is…
Q: Convert to cDNA and add linkers
A: This is the High-throughput sequencing that has become the revolutionary technique for the…
Q: 6) The figure that follows shows DNA fingerprint analysis of the genomic DNA from semen associated…
A: Creating an artificial gene is commonly referred to as DNA printing. There are several methods for…
Q: identical in all EVOLUTION LINK The reactions of glycolysis are organisms-prokaryotes, protists,…
A: Cellular respiration is a metabolic process that takes place inside the cell resulting in usage of…
Q: 26) Eukaryotes are unable to couple transcription and translation because: A) the two processes…
A: Introduction: RNA serves as a template for the production of proteins. Aligning the set of…
Q: Calculate the number of grams needed to prepare 100 mL of a 0.20 M solution of cobalt sulfate…
A: 1 mole of a substance is equal to that substance's Molecular weight The molecular weight is cobalt…
Q: Question 3 Part 1: Biological invasions have proliferated in recent decades because of increased…
A: An organism that has been introduced and has overpopulated and harmed its new environment is said to…
Q: a) Based on this tree is the chicken, mouse, human, or hamster most closely related to the bat? b)…
A:
Q: How are lipids related or important to Grease-Spot test, Solubility Test, and Emulsification?…
A: Introduction The human body's ability to maintain homeostasis depends on fats and lipids. One or…
Q: The soil bacterium Agrobacterium tumefaciens, also regarded as 'nature's own genetic engineer', is…
A: Introduction- Agrobacterium is a genus of Gram-negative bacteria established by H.J.Conn that uses…
Q: Which enzyme is used for catalyzing the phosphorylation of glucose as well as the phosphorylation of…
A: Cellular respiration is a phenomenon in which glucose is used and of liberation of ATP takes place .…
Q: Considering the anatomy of reptiles and amphibians explain the difference between these two 2…
A: Reptiles and amphibians are the important organisms under the animal kingdom. They are tetrapods…
Q: Autodock, Gold and Glide are other bioinformatics tools that are widely utilized by many researchers…
A: A technique called molecular docking examines how molecules are oriented and conformed within a…
Q: How is it possible that we are able to identify correlations between phenotype and some patterns of…
A: Phenotypes, which comprise an organism's appearance, growth, and behavior, are the observable…
Q: A) What module can we use to run BLAST over the internet in Biopython: Bio.Blast.NCBIWWW…
A: Biopython is a popular application programming interface (API) containing free tools, and are…
Q: Polymerase chain reaction (PCR) is a technique that enables multiplication of specific DNA sample at…
A: The polymerase chain reaction (PCR) was hugely successful in molecular biology. PCR tests are…
Q: ____Synaptic potentiation ____ _________results when a presynaptic cell is stimulated repeatedly
A: Synaptic potentiation, synaptic potentiation results when a presynaptic cell is stimulated…
Q: What are the forces that affect muscle strength?
A: Introduction: One of the three important muscle tissues in the human body is found in the skeleton.…
Q: What makes transparent softening lotion different from suspension softening lotion? Is it because of…
A: Cosmetics can be differentiated into various sub-categories based on various features, such as:…
Q: Nitrogen fixation is the conversion of nitrogen in present in soil or organisms. Nitrogen fixation…
A: According to NASA, the earth's atmosphere comprises 78% nitrogen gas, 21% oxygen, 0.93% argon, 0.04%…
Q: Which of the following specifically explains why glucose uptake into intestinal cells happens in…
A: Active transport is selective and occurs against the concentration gradient. It is of two types…
Q: Which of the following hormones is secreted by the posterior pituitary gland? Group of answer…
A: Pituitary gland secretes different hormones that regulate different other endocrine glands present…
Q: What is predator management? What is the linkage between the evolution of prey and predator species…
A: 1) Predator management is a strategy used in wildlife management that aims to control the numbers of…
Q: Fill in the blanks. Blanks with the same letter are the same molecule. Molecules to use:…
A: Water is necessary for transpiration, photosynthesis, and respiration in order for plants to grow…
Q: Pituitary secretion of adrenocorticotropic hormone (ACTH) is inhibited by elevated levels of: Group…
A: Adrenocorticotropic hormone is also called as ACTH is the harmone released by the pituitary gland.…
Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…
A: Many people agree that one of the 20th century's most significant contributions to molecular biology…
Q: cule is subjected to complete striction digestion by (1) OKI alone, (2) HindIII alone, and (3) both…
A: Restriction enzymes are a special class of enzyme that cleaves the DNA molecule in particular sites.…
Q: Which of the following would count as evidence that two populations are different species, according…
A: Species is the unit of ecology. Many individuals of a same species that interact with each other…
Q: You are part of a group of researchers examining the survivorship and fecundity of Bengal Tigers…
A: Animals are illegally poached all over the world for fun or for their body parts. Over the last…
Q: The α-ketoglutarate dehydrogenase catalyzes the oxidation of α-ketoglutarate and in this reaction…
A: The oxidation of alpha - ketoglutarate is one of the most important step in the citric acid cycle or…
Q: What are the advantages of using genetically encoded calcium markers over other calcium markers?…
A: Ca2+ is a pervasive intracellular messenger that controls various cellular processes in many organ…
Q: A given substance would require active transport across a lipid bilayer into a cell if... (choose…
A:
Q: It is often stated that excess mortality (in general) is higher in low socioeconomic populations.…
A: Socio-economic population is a population where the population is related with the society by…
Q: A shuttle vector is a vector constructed so that it can propagate in two different host speci One of…
A: Shuttle vectors are mostly plasmid vectors that are compatible with two host cells thereby allowing…
Q: The plasmids from the pUC series are created in the University of California. They carry a lacZ gene…
A: The pUC series plasmids have a lacZ gene that act as a selectable marker. The lacZ gene contains the…
Q: )One girl in every two has brown hair. One girl in every three has dimples. What is the probability…
A: A: Probability of 1 girl in every 2 having brown hair is 1/2.B: Probability of one girl in every…
Q: Polymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This technique had indeed…
A: The annealing temperature is the temperature at which the primers bind to the denatured DNA strands.…
Q: What is the difference between additive and compensatory morality? What is the difference between…
A: Please follow steps 2 & 3 for detailed explanation.
Q: How do Southern blotting, Northern blotting and Western blotting
A: in genetically modified organism all above three specific separation technique are used for genes…
Q: The dose of a drug is 500 mcg/kg of body weight. H ow many milligrams should be given to a child…
A: Given that, the drug dose is 500 mcg per kg of body weight and the weight of child is 55 lbs.
Q: What determines the resolution limit of a microscope? Is the purpose of the fluorescence microscope…
A: Limit of Resolution is the ability of objective lens two clearly separate the two points of the…
Q: Use the following information to answer the next question. The Canada lynx has a diploid number of…
A: Chromosome is an elongated thread like structure which is present inside the nucleus of the cell. It…
Q: 7.18 In Drosophila, the genes st (scarlet eyes), ss (spineless bris- tles), and e (ebony body) are…
A: Introduction :- any alteration to a cell's DNA sequence. Mutations may result from errors made…
Q: Acetylcholine is a neurotransmitter that, when bound to its receptor, causes the receptor to open a…
A:
Q: What two important characteristics allow us to identify a cell in interphase?
A: An active living cell undergoes two major phases - the mitotic phase where the cell divides into two…
Q: a. Briefly describe the pharmacokinetics of inhaled nicotine. Would you expect pharmacokinetics of…
A: Nicotine is a naturally produced alkaloid in the nightshade family of the plants . It is widely used…
Q: Yeast Culture 1. Saccharomyces cerevisiae 2. Schizosaccharomyces pombe 3. Rhodotolura rubra 4.…
A: Yeast are the eukaryotic organisms called as fungi. These also includes mushrooms and molds. Yeast…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- This is a Multipolar Neuron, please use ARROWS to label the following: Soma nucleus glial cells dendrites axonClassify the given items with the appropriate group. Neuron is hyperpolarized Occurs when voltage-gated sodium channels have returned to resting state No amount of stimulus will initiate a second action potential Ensures that the action potential moves down the axon in only one direction Voltage-gated sodium channels are opened then closed in the inactivated state Occurs about 1 millisecond after an action potential Relative Refractory Period Absolute Refractive PeriodClassify the given items with the appropriate group. Voltage-gated sodium channels are opened then closed in the No amount of stimulus will initiate a second action inactivated state potential Occurs when voltage-gated Occurs about 1 millisecond after sodium channels have returned an action potential to resting state Another action potential can be initiated, but only with a particularly strong stimulus Neuron is hyperpolarized Absolute Refractive Period Relative Refractory Period
- The following structure houses cell bodies of 1st order sensory neurones: select one: a b c d e f g hIdentify and describe the following on the diagrams below: 1. Dendrites 2. Axon 3. Cell body 4. Myelinated nerve fiberMatch the following statements to the type of cell in the eye each describes (rods or cones). Select "Both" if the statement is true of both cell types. Rods Directly detects light coming into the eye. Different types of this cell Cones respond to different wavelengths (colors) of light. More sensitive to low levels of light. Rods Found in high concentrations at the fovea centralis. Cones < <
- [Na*] [K*] This diagram is a drawing of normal conditions that occur in a neuron's axon (not all details are included). This stage that a living neuron would be in, would show that O no positive ions are inside the cell current is traveling down the axon O the cell will be at rest once the Na ions enter the cell O the cell is at rest O Na ions are predominantly outside the cellFigure 35.3 Which of the following statements is false? The soma is the cell body of a nerve cell. Myelin sheath provides an insulating layer to the dendrites. Axons carry the signal from the soma to the target. Dendrites carry the signal to the soma.You have a photoreceptor cell in a dish. You are recording its membrane potential while flashing different intensities of light. Which of the following would you observe? Group of answer choices The cell hyperpolarizes, with brighter light causing more hyperpolarization than dimmer lights The cell depolarizes, with brighter light causing more depolarization than dimmer lights If the light is bright enough to reach threshold, it will fire an action potential No change in membrane potential will be observed
- Identify and label the following structures on the neuron model figure below: cell body, dendrites, neuron nucleus, neurolemma, axon hillock, nucleus of Schwann cell, Nissl bodies, myelin sheath, axon, node of Ranvier, axon terminals (of neurons synapsing with model neuron), endoneurium (refer to Figure 10.6). 3) 11Which of the following occurs when light activates a photoreceptor? Choose all that apply. Glutamate will be released The cell will be depolarized Phosphodiesterase is inactivated [Sodium ions channels will be closed CGMP is presentA F B C- D Match the labelled synapse structure with the correct structure or function. Place the correct number in each blank. Use each letter only once. Synaptic vesicle containing the neurotransmitters Postsynaptic membrane of the dendrite Synaptic cleft Receptor site for the neurotransmitter on the dendrite Axon terminal Mitochondria, which supply ATP for synthesis of transmitters