Answer the following scenario like you are the experts in the field of genetic engineering. Write your answers below. A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood- clotting protein. He knows that the nucleotide sequence of a small part of the GTGGACTGACA. Briefly explain how to obtain the desired gene. gene is
Q: Why are cell membranes disrupted by soap?
A: Please note that of the two unrelated questions posted together, the first one has been answered…
Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…
A: A mutation is a change in a DNA sequence.
Q: Identify the type of mutation that occurred to produce the abnormal hemoglobin. Explain why you…
A: Nonsense mutation: This is a condition in which a protein loses its function, resulting in sickness…
Q: Each of these six terms fits into one (and only one) of the following blanks: bases, proteins,…
A: Gene regulation involves cellular processes that control the rate and manner of gene expression. A…
Q: With regards to this sequence below please answer this quistions 1) What is the format of the…
A: answer given below
Q: A molecular geneticist hopes to find a Gene in human liver cell that codes for an important…
A: In heredity, gene occupies the basic physical and functional unit. They are found to be composed of…
Q: Sickle cell anemia occurs due to a point mutation in a gene for hemoglobin protein. This mutation…
A: Sickle cell anemia occurs due to point mutation in a gene for hemoglobin. Its symptoms are - fatigue…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: With the help of the Human Genome Project, it has now become possible to sequence all of the genes…
Q: ndom mutations anywhere within the genome in living cells (in vivo) b) random…
A: In research to create mutations it is very necessary to first decipher the type of organism in which…
Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…
A: Mutation is defined as the change in the nucleotide sequence of DNA.
Q: Refer to a genetic code table for the question. below is a portion of the template strand of a…
A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…
Q: What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and…
A: Please follow step 2 for detailed explanation.
Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…
A: The cell is the basic structural and functional unit of the body. The nucleus is called the brain of…
Q: In relation to central dogma of molecular biology answer the following questions: The following…
A: Central dogma of molecular biology depicts how information in the DNA is transcribed into RNA and…
Q: NASA has identified a new microbe present on Mars and requests that you determine the genetic code…
A: Introduction RNA is an abbreviation for ribonucleic acid, a nucleic acid found in all living cells.…
Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…
A: Mutations are the changes in the genome resulting in synthesis of different products. These changes…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: A desired gene is defined as the insertion of copies of the gene into the living cells in order to…
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: Transcription -- Transcription is a process in which DNA sequence is copied to form an RNA molecule…
Q: Can you spell your name (or someone else's) using the one-letter amino acid abbreviations? If so,…
A: The RNA is formed from the DNA by the process of transcription. The protein is formed from the RNA…
Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…
A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…
Q: All the cells of one organism share the same genome. However, during development, some cells develop…
A: Developmental biology and stem cell biology helps us to understand more about the fate of cells. The…
Q: (select all correct answers) Each transposon must have Select one or more: O a. two inverted repeats…
A: A transposable element (TE, transposon, or jumping gene) is a DNA sequence that can move around…
Q: The following eukaryotic DNA sequence is a made up gene. It contains a promoter (green), a coding…
A:
Q: Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the…
A: In molecular biology the central dogma states the transcription and translation process in order to…
Q: The human genome has approximately 30,000 genes, but human cells can produce over 100,000 different…
A: The human genome consists of complete set of sequences of nucleic acid which are encoded as DNA.…
Q: A noncoding DNA sequence within a gene is called a(n) _____________.
A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid. It is the genetic material of all…
Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…
A: The change in the heritable characteristics of the species across many generations is called…
Q: Consider the following gene with their respective introns and exons 5’ –…
A: Since you have asked multiple questions, we will solve the first three question for you. If you want…
Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: The nucleotides sequence of the small part of the gene of interest is GTGGACTGACA as given in the…
Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…
A: Answer. Transcription is a process of the formation of transcript (RNA). It takes place by the usual…
Q: Transcribe the following DNA sequence from HbS. Record your answer to submit for grading. DNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Refer to the sequence below to answer the following questions. 5’-…
A: DNA is a double-stranded molecule. Each strand has a polarity, such that the 5'-hydroxyl group of…
Q: The following eukaryotic DNA sequence is a made up gene. It contains a promoter (green), a coding…
A: Most eukaryotic genomes are bigger and more complicated than prokaryotic genomes. Eukaryotic genomes…
Q: Please draw or send me a picture of the structure of DNA and label the parts. Thank you very much.
A: Deoxyribonucleic acid: DNA is a genetic material that is present within the nucleus. It was…
Q: THE MOLECULAR GENETICS OF CYSTIC FIBROSIS The following is the base sequence of DNA that codes for…
A: Introduction One strand of DNA holds the information that codes for various genes. This strand is…
Q: Sickle cell anemia occurs due to a point mutation in a gené för changes the amino acid at position 6…
A: Red blood cells are small, round, and convex cells that transport oxygen throughout the body.…
Q: Complete each sentence with the appropriate term or phrase. (Each box can be used only once, and not…
A:
Q: THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes…
A: Note: You have asked multiple sub part questions but as per our instructions we are instructed to…
Q: You are given the following sense DNA sequence:…
A: Solution According to chargaff rule In DNA the Pyrimidine Thymine (T) always pairs with the Purine…
Q: You are a researcher studying a gene you think is responsible for super human strength. You call the…
A: The two primers that is the forward primer and the reverse primer gets attached to different ends of…
Q: In the table below, there are four versions of gene A, one of which is normal, and the other three…
A: Mutations are sudden heritable changes that change gene expression. These changes in gene expression…
Q: 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the…
A: Given: 3’ T A C A T G C C G A A T G C C 5’ To find: 1. Partner…
Q: Based on the sequence data below. Which of the indicated sections of the sequence can you trust to…
A: DNA (Deoxyribonucleic acid) sequencing is an essential component of molecular biological studies.…
Q: Transcription and translation both involve an initiation, elongation, and termination phase.…
A: Answer (1) :- Fragments of DNA that are responsible for different traits are known as genes. The…
Q: Which of the following mutations in the protein-coding region of a gene is more likely to lead to…
A: A frameshift mutation is a type of gene mutation in which the insertion or deletion of one or more…
Q: Please choose the correct answer. Which of the following statements is NOT true about reverse…
A: Which of the following statements is NOT true about reverse transcription The correct answer would…
Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…
A: Transcription is a process through which the double stranded DNA transcribes itself into a single…
Q: What are the steps in DNA Methylation? Take note, that important enzymes and chemicals are needed in…
A: We must provide an explanation of the steps involved in DNA methylation in accordance with the…
Q: a molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: As given in the question, there is a particular gene in the human liver cells that quotes for an…
Q: Use the codon chart to translate the following MRNA transcript into a protein. Please format your…
A: The synthesis of proteins with the help of m RNA is know as translation.
Step by step
Solved in 2 steps
- A 4. You are given three different substances that are known mutagens. Using a variety of techniques, you analyze the results of exposure to these substances. Your findings are shown in the table below. Using this data, link each of the three substances with one of the following molecular properties and explain your choice. B C I. Substance II. III. One mutagen that looks like cytosine but forms a covalent bond with guanine One mutagen that can bind with either adenine or guanine A molecule that can insert itself between two base pairs in a DNA strand Result of exposure Increases the number of mutants that produce mRNA with AGA codons instead of AAA codons Significantly fewer viable colonies Increase in mutants containing frameshift mutationsPart II. Give what is needed. |Original DNA Sequence: TACACCT T G G C G A C G A C T MRNA Sequence: | Amino Acid Sequence: Mutated DNA Sequence #1: T A C A T C T T G G C GAC GA C T What's the mRNA sequence? (Circle the change) What will be the amino acid sequence? . Will there likely be effects?. What kind of mutation is this? Mutated DNA Sequence #2: T A C G AC C T T G G C G A C G AC T What's the mRNA sequence? (Circle the change) What will be the amino acid sequence?. Will there likely be effects?. What kind of mutation is this? Mutated DNA Sequence #3: T A C A C C T T A G C GAC GA C T What's the mRNA sequence? (Circle the change). What will be the amino acid sequence?. Will there likely be effects? | What kind of mutation is this? Mutated DNA Sequence #4: T A C A C C T T G G C GACTAC T What's the mRNA sequence? (Circle the change), What will be the amino acid sequence?. Will there likely be effects? - What kind of mutation is this? Mutated DNA Sequence #5: T A C A C C T T G G G A C…Content ← → C 9. b. Biol 1406-Lec 17 Gene Exp X acconline.austincc.edu/ultra/courses/_891351_1/cl/outline Blackboard Learn Which of the following statem X Which of the following statements is not true? O Bioinformatics is the use and application of computational methods to store and analyze biological data. O Transposable elements are genetic markers used for DNA identification purposes in the genome. O Proteomics if the study of proteins coded for in the genome. O Linkage mapping, physical mapping, and DNA sequencing are often performed to determine the sequence of an individual's genome. O Linkage maps show the location of genetic markers on chromosomes and physical maps show the distance between genetic markers usually in numbers of base pairs. Which of the following statements about viruses is not true? O Viruses are acellular particles which can only reproduce within a host cell. O All viruses are composed of a nucleic acid, capsid, and membranous envelope. O Restriction enzymes…
- ule 11 Making Cells – 202 Bb Module 11 Making Cells - 2021 X Bb Take Test: "Lab 11 Homework - X + A sunyocc.open.suny.edu/webapps/assessment/take/launch.jsp?course_assessment_id=_109869_1&course_id=_53817_1&c Question Completion Status: D. Organelle A. Two identical that builds copies of DNA microtubule "highways" to guide DNA B. "staple" that holds DNA copies together C. DNA that is same length and has same instructions; one from mother and one from father Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All Answers MacBook DD 00 000 F8 F6 F7 F4 F5 F2 F3 F1 * $ % & @ # 2 3 4 * CO < ODescribe your amplicon based on molecular size. Comparing the size of the genomic DNA Describe your amplicon based on molecular size. Comparing the size of the genomic DNA (as seen in Fig. 8.1) and the PCR products based on band position in the gel (as seen in Fig. 8.2).8 points total. Within the general field of biotechnology, DNA technology uses modern laboratory techniques for the studying and manipulation of genetic material. Explain how DNA might be sequenced, analyzed, and "cut and pasted" as DNA technology is employed. In addition, outline one way in which DNA technology could be employed to improve human lives. I 3
- Please answer fast 1. Genome annotation refers to all of the following except a. assigning a unique identifier given to a DNA or protein sequence recordb. locating genes in sequencesc. adding known functions to the sequenced. assigning the sequence to a functional categorye. All of the above are correct 2. Which of the following databases contain curated annotations about human genes? a. GENCODEb. RefSeq c. UniProtKBd. All of the above 3. Which database covers a wider range of functional definitions and therefore would bea better choice for exploring the genome for new genes? a. GENCODEb. RefSeqc. UniProtKBd. All of the above 4. AKT1 is the official ___________________ for a gene. a. gene IDb. namec. symbold. all of the above 5. Which BLAST (Basic Local Alignment Search Tool) variant would you select toconduct a translated nucleotide query? a. BLASTnb. BLASTpc. BLASTxd. TBLASTne. TBLASTxConcept 23. A gene is a discrete sequence of DNA nucleotides. This concept describes the discovery of the DNA sequencing technique that made modern biology and bioinformatics possible. The method was later used to sequence the human genome and genomes of many other organisms. This led to the accumulation of great numbers of nucleotide and protein sequences in the numerous databases. The concept 23 web page is here: http://www.dnaftb.org/23/ After reading the Concept page, answer the following questions. What was the Mendel’s definition of a gene? How was it different from the definition by Beadle and Tatum? Describe proteins based on the early sequencing efforts. What was the definition of a protein coding gene based on the genetic code? What are the beginning and ending codons of the gene’s protein coding sequence? What is the name of the method that makes use of a “defective” DNA nucleotide? After reviewing the Animation pages, answer the following…Explain Shortly. I need help The emergence of new molecular biology techniques has allowed researchers to determine DNA sequences quickly and efficiently. A) How could knowledge of a DNA sequence be abused? B) How could knowing a DNA sequence be helpful? C) Would you ever consent to having your DNA sequenced. Explain your answer
- Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…Genetics in Practice case studies are critical-thinking exercises that allow you to apply your new knowledge of human genetics to real-life problems. Case study Michelle was a 42-year-old woman who had declined counselling and amniocentesis at 16 weeks of pregnancy but was referred for genetic counseling after an abnormal ultrasound at 20 weeks of gestation. After the ultrasound, a number of findings suggested a possible chromosome abnormality in the fetus. The ultrasound showed swelling under the skin at the back of the fetuss neck; shortness of the femur, humerus, and ear length; and underdevelopment of the middle section of the fifth finger. Michelles physician performed an amniocentesis and referred her to the genetics program. Michelle and her husband did not want genetic counseling before receiving the results of the cytogenetic analysis. This was Michelles third pregnancy; she and her husband, Mike, had a 6-year-old daughter and a 3-year-old son. At their next session, the counselor informed the couple that the results revealed trisomy 21, explored their understanding of Down syndrome, and elicited their experiences with people with disabilities. She also reviewed the clinical concerns revealed by the ultrasound and associated anomalies (mild to severe intellectual disability, cardiac defects, and kidney problems). The options available to the couple were outlined. They were provided with a booklet written for parents making choices after the prenatal diagnosis of Down syndrome. After a week of careful deliberation with their family, friends, and clergy, they elected to terminate the pregnancy. Should physicians discourage a 42-year-old woman from having children because of an increased chance of a chromosomal abnormality?A elearn.squ.edu.om/mod/quiz/attempt.php?attempt-D1335328&cmid%3D6971498&page%=D1 System (Academic) Answer: If a sequence of DNA has 20% Guanine bases how many Adenines would it have? Select one: О а. 10% ОБ.20% O c. 30% O d. 40% O e. 50% A scientist noticed that his sample of cvanobacteria moves towards the side of the petn di