An inflammatory condition that affects the sac of synovial fluid outs the joint cavity would best be described as which of the following? O bursitis O arthritis osteoarthritis O specific immune response

Q: Describe the different potentials for regeneration of the three types of adult muscle after injury

A: Muscle tissue is made up of cells that have been differentiated in order to make the best use of a…

Q: Name 2 sources of variation produced during meiosis.

A: Meiosis is a form of cell division in which the  reduction of the number of chromosomes to half…

Q: Who developed the sequencing-bysynthesis (SBS) approach? & When it was firstly used ?

A: Sequencing by synthesis (SBS), an Illumina sequencing method, is a commonly used next-generation…

Q: Explain the concept of Making a Transgenic Animal: The Basics ?

A: The production of transgenic domesticated animals has the potential to significantly improve human…

Q: describe the process of lysosomal hydrolase arriving to the lysosome. without including translation

A: The targetting of lysosomal enzyme depends on GERL system. Lysosome, Golgi bodies, endoplasmic…

Q: One of the most widely used means of communication among insects is chemical communication. How do…

A: *pheromones are chemicals released by an organism to external environment which takes specific…

Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…

A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…

Q: If a population’s allele and genotype frequencies remain constant from generation to generation, (a)…

A: The Hardy-Weinberg equilibrium (panmictic equilibrium) was discovered by a group of researchers or…

Q: What does it mean to say that action potentials are “all or none”?

A: Introduction :- A depolarizing current causes an explosion of electrical activity, which is known as…

Q: What are some of the advantages and disadvantages of utilizing insects as experimental animals in…

A:

Q: METABOLIC METABOLITES DISORDERS Alkaptonuria SYMPTOMS DIAGNOSIS Phenylketonuria Gout Ketosis Fatty…

A: Liver is the largest digestive gland of the body it contains several enzymes to control and regulate…

Q: What is environmental science? Name several disciplinesthat environmental science draws upon.

A: The term 'environmental science' is a term which is referred to a grouping of scientific…

Q: 1. A woman is colorblind. Construct a Punnett square and using versions of the letter “C” determine…

A: As per our company guidelines we are supposed to answer only first question or first 3 subparts of…

Q: If we were performing experiments on campus, how would you test the functions of excretory system?…

A: The organs and systems that remove waste from the body. For example, the organ system that regulates…

Q: Explain the key to the Sanger technique ?

A: DNA is a molecule discovered in the nucleus by Friedrich Meischer in the late 1860s, but its…

Q: Which of the following OPPOSE the movement of fluid from the capillary to the glomerular capsule?…

A: Capillary hydrostatic pressure It is the blood pressure in glomerular capillaries. Generally, It is…

Q: 4. You are looking at a series of rock layers and you want to survey the youngest stratum. How will…

A: The goal of island biogeography is to study the climatic conditions which affect the flora and fauna…

Q: In 1984, Carolyn Greider was using out the enzyme called telomerase that had the ability to add…

A: Chromosomes are the structures formed by the organised arrangement of the DNA molecules located…

Q: Explain how the three forms of adult muscle have various potentials for regeneration after injury.

A: Cell organelles are the building blocks of a cell. They are useful for conducting various cell…

Q: The buzzing of the alarm clock woke Halie. She stretched, yawned, and started to salivate as she…

A: The human nervous system is a "complex network" that includes the brain, nerves, and spinal cord and…

Q: What is Biological classification? What is the need of classification?

A: The naming of organisms by two words is referred to as biological classification. One is a generic…

Q: Explain why monarchs have different survival probabilities in species A and B

A: The monarch butterfly and natural milkweed plants have a symbiotic relationship. Monarch butterflies…

Q: The recognition sequence to which RNA polymerase binds at the initiation of transcription is found…

A: Ans- False The recognition sequence to which RNA polymerase binds at the initiation of transcription…

Q: The annual flu shot is composed of either live attenuated influenza virus or influenza subunits (the…

A: The shots of flu can be given in several forms, such as: Needle-free vaccine. Nasal spray. High…

Q: I1. Electrical impulses in muscle fibers are called 12. Groups of muscle fibers are that are…

A: The movement of skeleton muscles is voluntary in nature and regulated by central nervous system.…

Q: Discuss the eukaryotic transcription process and mention the enzymes and components needed in the…

A: Cell is the basic structural and functional unit of life. All cells contains nucleus within which…

Q: Complement can enhance phadocytosis because of the presence on macrophages and neutrophils of…

A: The correct option is C3b.

Q: When KO techniques was developed ?

A: The full form of KO is knock out and refers to gene knock out which means the gene that is knocked…

Q: Why are some fungi grouped under "fungi imperfecti"?

A: Deuteromycetes/Fungi imperfecti Some members are saprophytic or parasitic. A large number of…

Q: 11. Choose from the following types of inheritance and write in the 1st column which one is…

A: Inheritance  Inheritance is the biological process from which the genetic material is transferred…

Q: Explain comprehensively how the ganglia originated embryologically. How do these affect the role…

A: The sensory ganglia of the cranial nerves responsible for touch and gustation arise from two…

Q: How can the heart be strong enough to pump blood up your legs against gravity?

A: The heart is incapable of pumping blood back up the veins in your legs and back to your heart on its…

Q: Explain the sequencing-by synthesis (SBS) approach ?

A: One of the well-known states that are known as fundamental topics in Arithmetic is sequence and…

Q: Are the healthcare concerns, infections, and nosocomial infections discussed for genera…

A: Microbes, which are tiny and nearly invisible, have had a huge influence on society since the…

Q: 1. How do demographic factors affect population size? 2. Are the effects of these factors mutually…

A: Demography is the statistical and mathematical study of the size, composition, and spatial…

Q: What is the significance of the fact that couples who cannot taste PTC never have children who can?…

A: 1. couples who cannot taste PTC never have children who can taste PTC because when we cross between…

Q: What is the basic principle of GPC (gel permeation chromatography)?

A: Gel permeation chromatography is a type of size-exclusion chromatography that uses organic solvents…

Q: T or F. Motor signals originating in the cortex can't interfere with motor reflex response? T or F.…

A: 1) the correct answer is - TRUE but it has restrictions upto a limit. This statement is neither…

Q: Intermembrane space II IV 20000 00000 II NADH 1/2 02 Mitrochondrial inner membrane Matrix Figure 1.…

A: Cellular respiration is a metabolic phenomenon takes place inside the cell in which glucose is…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…

Q: Why do you think there are limited scientists like microbiologists that focuses in studying…

A: Archae are group of single celled prokaryotic microorganisms and are separate from bacteria.

Q: G and g are dominant and recessive alleles respectively, for a gene. If a mating of a gg female with…

A: According to the mendelian principle, the dominant characters is expressed and the recessive…

Q: Single strand invasion is promoted by Rad51 protein in Eukaryotes for repair of Double Strand…

A: Homologous recombination is the exchange of genetic material between two strands of DNA. It occurs…

Q: Describe the cerebrum, cerebellum, and spinal cord's white and gray matter areas. Include the…

A: Cerebrum is the largest part of our brain, it is a part of forebrain. It is related to the…

Q: Is GG a genotype or phenotype? __________ What gamete(s) are possible from a plant that is GG?…

A: * phenotypes means observable physical properties of individual like organism appearance and…

Q: What is the rationale for synthesizing and rapidly degrading p53 protein in the cell?

A: P53 is a nuclear transcription factor with pro apoptotic function as 50% of human Kansas carries…

Q: G and g are dominant and recessive alleles respectively, for a gene. If a mating of a gg female with…

A: As given in the question that G is  dominant allele and g is recessive allele.

Q: What is opsonization? What is the role of antibodies in this process?

A: When the immune system recognizes foreign antigen enters in the body, complement activation occurs.…

Q: Select all of the statements that are true regarding prions O Prions are infectious nuclelc acids. O…

A: Prion illnesses may affect living creatures as diseased meat products can occasionally transfer the…

Q: What is the following molecules not required for DNA synthesis during S- phase? * O RNA primer…

A: DNA replication is the process by which new DNA is synthesized from the old DNA. In case of…