Select all of the statements that are true regarding prions O Prions are infectious nuclelc acids. O . Normal PrP proteins have alpha-hellices, while infectious PrP proteins have beta pleated sheets. Prions are associated with many tissue types. Prions are diagnosed with a simple blood test. O Prions cause diseases known as spongiform encephalopathles Prions are living acellular entities Prions are misfolded proteins which can cause normal versions to also misfold. 0000000
Q: Explain the relationship of osmosis to enzymatic browning in potatoes?
A: Osmosis is the process of diffusion of solvent from the region of low concentrations of solute…
Q: Explain "Numerical taxonomy" briefly.
A: Introduction In this question we will explain the Numerical taxonomy.
Q: 2. Which is a better mode of reproduction sexual or asexual? Why?
A:
Q: Make a flow chart that shows how gases enter, pass through, and exit the bodies of the following…
A: As we know that the respiratory system consist of nose, pharynx , (throat ) ,larynx , trachea…
Q: What is environmental science? Name several disciplinesthat environmental science draws upon.
A: The term 'environmental science' is a term which is referred to a grouping of scientific…
Q: Make a simple schematic illustration of the connective tissue cell lineage descended from…
A: A cell is the smallest structural unit of an organism capable of autonomous functioning, consisting…
Q: Although most salamanders have four legs, a few species that live in shallow water lack hind limbs…
A: Natural selection refers to the evolution of species in such a way that the changes are better…
Q: process of eukaryotic transcription in detail and mention the specific enzyme
A: Transcription can be defined as the process of copying genetic information from one strand of the…
Q: You have now studied three different types of anatomical structures. Homologous structures show…
A: Comparative anatomy is the study of the "similarities and dissimilarities" between various objects.…
Q: Differentiate by drawing and describing the following and give distinguishing characteristic a.…
A: NOTE- as we are allowed to do only one question at a time. So I'm Providing answer to first question…
Q: What is the basic principle of GPC (gel permeation chromatography)?
A: Gel permeation chromatography is a type of size-exclusion chromatography that uses organic solvents…
Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame by filling…
A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…
Q: What are first-generation methods (the Sanger technique and capillary electrophoresis) ?
A: Sequencing is a term used in biology and genetic to describe the process of determining the main…
Q: What are the pros and cons to Clementsian and Gleasonian views of plant communities. List one pro…
A: *Clementsian is an American plant ecologist in study of vegetation succession. * Clements theory…
Q: In the garden pea, yellow pods (yp) are recessive to green pods (Yp) and straight tendrils (ct) is…
A: Given that, a plant with yellow colored pods and straight tendrils was crossed to a plant with green…
Q: PROCEDURE 1 Time to Trace! In this procedure, you will be tracing two invaders: bacteria in the…
A: Bacteria are microscopic, single-celled organisms that exist in their millions, in every…
Q: The table below shows the blood types of mothers and children. Complete the table by filling in all…
A: Blood grouping : For A blood group genotype = IAIA / IAi " B " " "…
Q: Which microevolutionary force typically changes genotype frequencies without changing allele…
A: The allele frequency shows the incidence of an allele or a gene variant in a population. Genotype…
Q: What are chimeras ?
A: A chimaera is a person that carries two completely different sets of DNA in their body. Sure, it's…
Q: 1. How do demographic factors affect population size? 2. Are the effects of these factors mutually…
A: Demography is the statistical and mathematical study of the size, composition, and spatial…
Q: Ammonia concentrations are very low. Using structural formulac, diagram vert one molecule of…
A: Introduction Ammonia production occurs in all tissues of the body during the metabolism of a variety…
Q: What is Binomial system of nomenclature? Who proposed this system? Why is binomial nomenclature the…
A: Binomial Nomenclature Carolus Linnaeus in the 1750s gave the formal naming system to organisms…
Q: Subject: Biopharmaceutical technology 1.Identify the types of water that are available and widely…
A: USP (US Pharmacopeia) is a designation that ensures that the water is purified and can be used in…
Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…
A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…
Q: Are there any parts of the human body that get oxygen directly from the air and not from the blood?
A: The answer is YES.
Q: DNA polymerase l moves toward the direction of replication fork creating Okazaki Fragments. * True…
A: Most living organisms that are well defined in terms of that they have DNA as their genetic…
Q: Aspartic acid has a side chain bearing a carboxylic acid group; its pK, is ~4. The alpha-carboxylic…
A: Aspartic acid have pka1 = 2.1 ( Alpha carboxylic) pka2 = 9.8 ( Alpha amino) pka3 = 3.9 ( side…
Q: what are the advantage and disadvantages of planting native trees in an urban area
A:
Q: What is the common ground between evolutionary biologists and developmental biologists who have…
A: Evo-Devo is well stated that they are been sued as the abbreviation for evolutionary developmental…
Q: Describe briefly the generation of the active form of the transcription factor NFAT. Include the…
A: Nuclear factor of activated T cells (NFAT) was first identified as a Ca 2+/calcineurin-regulated…
Q: Which of the following is true about Liebig's Law of the Minimum? A. The growth of a plant is not…
A: Justus von Liebig popularised Liebig's law of the minimum, also known as Liebig's law or the law of…
Q: Name the guidelines for naming of organisms?
A: There are much greater number and kinds of living organisms. Is different kinds of plan animal…
Q: How can researchers test the hypothesis that clinal variation among populations of a particular…
A: A gene is a functional unit on a chromosome that is passed down from parents to offspring in order…
Q: Discuss the problem that there still is too many people that have diabetes link it to type 2…
A: People with type 2 diabetes have difficulty using glucose (sugar) from food as energy. After a meal,…
Q: G and g are dominant and recessive alleles respectively, for a gene. If a mating of a gg female with…
A: According to the mendelian principle, the dominant characters is expressed and the recessive…
Q: Explain how and why the queen honey bee abort the sexual maturation of the worker bees?
A: Honey bees are eusocial insects.These insects have permanent division of labour.
Q: biologists were able to estimate that, on average, only 5 fisher kits (young animals) survived to…
A: Setting fishing limits, modifying fishing methods, creating aquaculture techniques, and identifying…
Q: What is the genetic significance of mitosis (I.e., how do the daughter cells compare to the original…
A: Mitosis is the equational division, which means at the end of this type of cell division, two…
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Q: The Theory of Use and Disuse suggests that an organism’s body part may develop or disappear…
A: The evolution of organisms depends on several factors. The study of evolution mainly based on…
Q: phrases are used.) CODIS The most useful DNA markers for forensics are in the population and do not…
A: The most useful DNA markers for forensics are SSR in the population and do not contribute to…
Q: 11. Choose from the following types of inheritance and write in the 1" column which one is described…
A: Please follow step 2 for a detailed explanation of the inheritance mode of the given situations.
Q: Why do organisms with close biochemical similarities show stronger evolutionary relationships? *…
A: The answer is (c)they have the common ancestors and have the same kind of proteins.
Q: 17a. Assuming that both types of pom-poms are present in the population, what do you think would…
A: *Natural selection is due to when individuals of genotypes are more likely than individuals with…
Q: What are the promises and future uses of research in archaea?
A: Bacteria are microscopic single-cell prokaryotic organisms found in the environment. They are…
Q: explain the processes that occur during the act of defecation
A: Defecation is the final act of digestion, by which organisms eliminate solid, semisolid, or liquid…
Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…
A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…
Q: Name three neural pathways one might expect to lead into the hypothalamus that would result in…
A: * Neural pathway is connection formed by axons from neurons to make synapses to neurons in another…
Q: 5. Describe a density-independent factor and explain why its effect on population growth is…
A: Food or nutrient shortages, environmental pollutants, and climate extremes, such as monsoons, are…
Q: What is the relationship of osmosis to enzymatic browning?
A: Enzymatic browning is a process of food turning brown in color.
select true statement.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The following statement(s) is/are .6 * correct about bacteriophages exiting 1 E) Virions of bacteriophages exit by lysing bacterial cells Bacteriophages may break down cell wall's peptidoglycan by producing enzymes Bacteriophages may inhibit host enzymes with roles in cell wall synthesis Bacteriophages lyse bacterial cells by covering their virions with cell membranes a, b, and c a, and bRegular herpesvirus-mediated cold sores or genital sore flare-ups are caused by reinfection by the same herpesvirus strain reinfection by a closely related herpesvirus of a different strain copies of the herpesvirus genome permanently maintained in host cell cytoplasm copies of the herpesvirus genome permanently maintained in host nucleiWhich of the following is not associated with prions? Replicating shapes Mad cow disease DNA Toxic proteins
- There have been recurring cases of mad-cow disease in the United Kingdom since the mid-1990s. Mad-cow disease is caused by a prion, an infectious particle that consists only of protein. In 1986, the media began reporting that cows all over England were dying from a mysterious disease. Initially, there was little interest in determining whether humans could be affected. For 10 years, the British government maintained that this unusual disease could not be transmitted to humans. However, in March 1996, the government did an about-face and announced that bovine spongiform encephalopathy (BSE), commonly known as mad-cow disease, can be transmitted to humans, where it is known as variant Creutzfeldt-Jakob disease (vCJD). As in cows, this disease eats away at the nervous system, destroying the brain and essentially turning it into a spongelike structure filled with holes. Victims experience dementia; confusion; loss of speech, sight, and hearing; convulsions; coma; and finally death. Prion diseases are always fatal, and there is no treatment. Precautionary measures taken in Britain to prevent this disease in humans may have begun too late. Many of the victims contracted it over a decade earlier, when the BSE epidemic began, and the incubation period is long (vCJD has an incubation period of 10 to 40 years). A recent study concluded that 1 in 2,000 people in Great Britain carry the abnormally folded protein that causes vCJD. In spite of these numbers, the death rate from vCJD remains low. It is not clear whether this means that the incubation period for the disease is much longer than previously thought, or whether they may never develop the disease. If you were traveling in Europe, would you eat beef? Give sound reasons why or why not.There have been recurring cases of mad-cow disease in the United Kingdom since the mid-1990s. Mad-cow disease is caused by a prion, an infectious particle that consists only of protein. In 1986, the media began reporting that cows all over England were dying from a mysterious disease. Initially, there was little interest in determining whether humans could be affected. For 10 years, the British government maintained that this unusual disease could not be transmitted to humans. However, in March 1996, the government did an about-face and announced that bovine spongiform encephalopathy (BSE), commonly known as mad-cow disease, can be transmitted to humans, where it is known as variant Creutzfeldt-Jakob disease (vCJD). As in cows, this disease eats away at the nervous system, destroying the brain and essentially turning it into a spongelike structure filled with holes. Victims experience dementia; confusion; loss of speech, sight, and hearing; convulsions; coma; and finally death. Prion diseases are always fatal, and there is no treatment. Precautionary measures taken in Britain to prevent this disease in humans may have begun too late. Many of the victims contracted it over a decade earlier, when the BSE epidemic began, and the incubation period is long (vCJD has an incubation period of 10 to 40 years). A recent study concluded that 1 in 2,000 people in Great Britain carry the abnormally folded protein that causes vCJD. In spite of these numbers, the death rate from vCJD remains low. It is not clear whether this means that the incubation period for the disease is much longer than previously thought, or whether they may never develop the disease. What measures have been taken to stop BSE?Which statement is not true of viral replication? A lysogenic cycle kills the host cell There are six basic steps in the viral replication cycle Viral replication does not affect host cell function Newly released virions can infect adjacent cells.
- Choose all the true statements regarding coronavirus proteins. Vaccine preventable diseases include COVID-19. For coronaviruses, it is more likely to find evolving mutations in the portion of the spike protein than the nucleocapsid protein. Mutations in the genetic code for the spike protein will produce 3D changes that are more likely to affect vaccine efficacy than changes to the nucleocapsid protein code. The nucleocapsid protein interacts with viral nucleic acid specifically whereas the spike protein interacts with the host protein non-specifically.CAN Corynebacterium diphtheriae be infected by a viruses. I know it is a bacteria but I need to know if it is possible for it to be infected by a virus. Please be specific but in terms that is easy to understand. PLEASE answer this specif question. I don't need to know the causes, effects, outcomes, etc of Corynebacterium diphtheriae. I already know that stuff, I need this specific question answered. THANK YOU.viruses:1. Why must primary cell cultures be restarted every so often when preparing primary cell cultures to observe morphological changes caused by cells infected by a virus? Why are tumor cells preferred? 2. Why are non-enveloped viruses generally more resistant to disinfectants than are enveloped viruses? 3. A public health physician isolated large number of phages from rivers used as a source of drinking water in western Africa. They physician is very concerned that humans might become ill from drinking this water, although she knows that the phages specifically attack bacteria. Why is she concerned?
- Polyomavirus and Papillomavirus, which is NOT correct? are circular dsDNA are icosahedral capsid are non-enveloped contain DNA and RNA polymerase their fusion with the host cell doesn’t involve in uncoating genome replicate in cytoplasm None of the above Both D and F D, E, and Ffalse true Viruses do not reproduce .within host cell Phagocytosis is type of Lactive transport R.B.Cs have no mitochondria Phospholipids have similar structure to fat Prokaryotic cell has no mitochondria Channel protein form a small opening through the cell membrane All nucleic acids have no oxygen In prophase stage chromosomes become shorter Cell is defined as basic functional unit of living .organism Phospholipid bilayer of cell membrane has hydrophilic head only O OCan you help? I cannot seem to figure out all of the correct answers. I know lysis and budding is one but what is the other (s)? I am so lost! Thanks! Can Egress by viruses from the host cell occur by lysis or budding? Does egress by viruses immediately kill it? Does egress by viruses from the host cell happen after replication of its protein and genetic components and before assembly into new viruses? Is egress by virus from the host cell part of either lytic or lysogenic cycles?