An analysis of the genetic material of an unknown sample showed that it contains 1996 adenine bases, 2131 guanine bases, 1642 uracil bases and 2365 cytosine bases. Which one of the following describes the genetic material of the unknown sample? * Single Stranded DNA Single Stranded RNA O Double Stranded DNA Double Stranded RNA

An analysis of the genetic material of an unknown sample showed that it contains 1996 adenine bases, 2131 guanine bases, 1642 uracil bases and 2365 cytosine bases. Which one of the following describes the genetic material of the unknown sample? * Single Stranded DNA Single Stranded RNA O Double Stranded DNA Double Stranded RNA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).
The technique of dideoxy sequencing of DNA is described inChapter 20. The technique relies on the use of dideoxyribonucleotides(shown in Figures 20.5 and 20.16). A dideoxyribonucleotidehas a hydrogen atom attached to the 3′-carbon atom insteadof an –OH group. When a dideoxyribonucleotide is incorporatedinto a newly made strand, the strand cannot grow any longer.Explain why.
There is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Pleasedraw the all-atom structure of this RNA strand, including that of the phosphategroup, the pentose (ribose), and the base for each nucleotide. The structure is inthe 5’→3’ direction
A typical bacterial DNA has a molar mass of 4 × 109 g m ol-1 . Approximately how many nucleotides does itcontain?
Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings and diagrams to describe how the DNA strand will be synthesized into a functional protein.5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’(KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D)
In sea urchin DNA, which is double stranded, 17.5percent of the bases were shown to be cytosine (C). Whatpercentages of the other three bases are expected to bepresent in this DNA?
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).
If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
A genetics student was asked to draw the chemical structureof an adenine- and thymine-containing dinucleotide derivedfrom DNA. His answer is shown below. The student made morethan six major errors. One of them is circled, numbered 1, andexplained. Find five others. Circle them, number them 2 to 6, andbriefly explain each by following the attached given.