A thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which statement explains how the change in the DNA codon leads to this disorder? * O The frameshift mutation stops the production of a protein in the organism. O The substitution causes a different protein to be produced in the organism. The insertion mutation caused the production of extra protein inhe organism. The deletion mutation prevents the production of an important protein in the organism. Which type of mutations are the least harmful to an organism? * O Duplication O Substitution Insertion

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: Hi, Thanks For Your Question.  Answer : Let's Learn Some Basic Concepts First: Transcription : It Is…

Q: mutation in a gene’s exons is more damaging than a mutation in a genes intron. Do you agree or…

A: DNA sequences consists of two parts exons and introns. Exon is that part of the DNA which directly…

Q: Luria and Delbruck's experiemnt demonstatred that  mutation of genetic materials is a random event…

A: Bacteria is a prokaryote and posses circular genome along with plasmids (not genomic…

Q: A thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which…

A: There are different types of mutations which involves- Deletion mutation, insertion mutation,…

Q: A thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which…

A: Mutation refers to the change in the sequence of nucleotides in a DNA molecule which acts as the…

Q: Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What…

A: Gene expression is the process by which the instructions in our DNA are converted into a functional…

Q: What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5'…

A: Transcription: The process of formation of RNA from the DNA by  action of DNA dependant RNA…

Q: Queștion 1: The protein Collagen alpha-1 has 1671 amino acids. From start to stop codon, how long…

A:

Q: he correct mRNA strand and amino acid sequence into the appropriate boxes to represent how the…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Where in a gene would a 4-bp insertion mutation havethe least effect on gene expression?a. Intronsb.…

A: Mutation is defined as the change in genetic makeup triggered by natural or man made processes. The…

Q: How is a protein made in the cell? * O One strand of DNA in the ribosome combines with amino acids.…

A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: Yes, all mutations change the resulting protein. No, the amino acid sequence has not been changed.…

A: Deoxyribonucleic acid (DNA) is the material that carries inheritable information to the succeeding…

Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…

A: BASIC INFORMATION  TRANSLATION  It is the process in which protein is which formed from the…

Q: For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA…

A: Gene expression is the process by which the instructions in the DNA is converted into a functional…

Q: A promoter is ________.a. a specific sequence of DNA nucleotidesb. a specific sequence of RNA…

A: The correct answer is (a) a specific sequence of DNA nucleotides.

Q: nclude the ideas of transcription and translation. Compare the normal and abnormal strands to see…

A: Transcription : It is the process of making an RNA copy of a gene sequence . This copy is called…

Q: Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C.…

A: Hello, thank you for your question, since you have not mentioned the DNA orientation I am answering…

Q: Cellular transcription is : O Use of DNA as a template to make complementary DNA O Use of DNA as a…

A: Transcription is the molecular process by which the DNA sequences are transcribed to the don…

Q: Select all that apply: Beginning at the 5' end of the DNA, which answer choices place a gene's…

A: Gene or DNA is the basic mode of transfer of inheritance from one organism to another (parents to…

Q: A codon for leucine is UUA. A mutation causing a single-base substitution in a gene can change this…

A: Mutations are the errors in codons caused by changes in nucleotide bases. Some mutations may not…

Q: DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA

A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense…

A: A nonsense mutation is one in which change in nucleotide will result in a stop codon. This will…

Q: Which is the best definition of a genetic mutation? An error in a code. OA mistake during copying.…

A: A Mutation happens when a DNA gene is harmed or changed so as to adjust the hereditary message…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides is called a______? (choose…

A: Given condition: a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides.  Mutation…

Q: A science student claims that a substitution mutation is less likely to affect gene function than an…

A: A mutation occurs when the sequence of DNA changes. It can be caused by errors in DNA copying during…

Q: Which is the DNA template given if the MRNA is 3- CGGAUGCCCGUAUAC -5 ? O 3- GCCTACGGGCATATG-5 O 5-…

A: The common rule of Base pairing in DNA is: A pairs with T by a double bond and G pairs with C by a…

Q: Explain the reasoning that established a sequence ofthree nucleotides (a triplet codon) as the basic…

A: The genetic code can be defined as a set of rules through which the living cells convert the…

Q: It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…

A: The change in the heritable characteristics of the species across many generations is called…

Q: What is a gene? What does "base sequence" mean? If the base sequence of a segment of a molecule of…

A: Hello! Since you have posted multiple questions, we are answering only the first two questions.…

Q: Refer to the following illustration to answer the question. mobile genetic elements exon 1A…

A: Transposable genetic element are the DNA sequences which can shift their original locations and…

Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…

A: Protein consists of amino acids linked by amide bonds or peptide bonds.

Q: Which of the following mutations likely has the MOST significant impact on the function of a…

A: Mutations are the changes in the nucleotide sequence which may result in the change of protein…

Q: If a scientist wants to target a DNA sequence in a gene that reads TAC CCG GGC TTA, what should the…

A: * DNA is composed of nucleotide bases . Four nucleotide bases are present  Adenine Guanine Thymine…

Q: Create protein sequence with 10 elements. (Start with a codon and ends with a stop codon)

A: Protein sequencing is the cycle of deciding the amino acid arrangement of all or part of a protein…

Q: A particular triplet of bases in the coding sequence of DNA is AAA. The anticodon on the tRNA that…

A: If the template strand of DNA has AAA, it will be transcribed to mRNA as UUU. A tRNA that would…

Q: Addition or deletion of bases causes which kind of mutation? Select one: O a. Transversion O b. •…

A: Any heritable change that happens in the nucleotide sequence of the DNA is called a mutation.…

Q: ? 1. mRNA is formed with codons as product ons are translated and polypeptide chain is tr es into…

A: Genetic material- DNA and RNA acts as the genetic material in most of the organisms . DNA stands…

Q: Suppose you are studying two different mutations in a gene that codes for a protein. In the first, a…

A: Proteins are made up of amino acids that joins together by peptide bonds. The synthesis of protein…

Q: Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: a mutation occurred in the g of the codon below and the G became a C   A  T  G Changes to A  T  C…

Q: A protein was mutated at amino acid position 129. Which of the following mutations will least effect…

A: All amino acids share different properties.

Q: If you have 30 MRNA bases, how many amino acids would that code for? O 10 3 1

A: A triplet codon is where each codon consists of three, nonoverlapping, nucleotides.  The code is…

Q: Translation is ___: O Use of RNA as a template to make proteins O Use of DNA as a template to make…

A: Nucleic acids are the polymers of nucleotides. DNA and RNA are the two main types of nucleic acids.…

Q: Now imagine that a mutation occurred in the second T of the codon below and the T became a G. How…

A: A mutation occurs when there is a change in the nucleic acid sequence. These mutations could be…

Q: d. Which amino acid is represented by (6)? e. Give the one anticodon in the 5' to 3' direction that…

A: In this question, we are shown the process of protein formation from a DNA sequence. This takes…

Q: Which statement correctly describes a codon? a sequence of three nucleotides that may code for one…

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: insertions

A: Any change in the DNA sequence of an organism is called a mutation. Mutation can be of different…

Q: Consider a protein that has all the 20 common amino acids in its primary sequence. Explain three…

A: A protein is a polymer of amino acids. Each amino acid is made up of a side chain, a carboxylic acid…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.