DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed. DNA: mRNA: polypeptide chain: b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to: a. the right DNA: mRNA: polypeptide chain: b. the left DNA: mRNA: polypeptide chain:

DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed. DNA: mRNA: polypeptide chain: b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to: a. the right DNA: mRNA: polypeptide chain: b. the left DNA: mRNA: polypeptide chain:

Name: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’From the given DNA sequenc
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identi

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A frameshift mutation
In this sequence there are two introns and three exons. Exon 1 has 3 amino acids, exon 2 has 4 amino acids and exon 3 has 3 amino acids. Remember start and stop codons! Highlight the introns and number the exons. Show the start codon and stop codon and highlight and number the exons. Remember all introns start with GT and end with AG. 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' (a) How many base pairs are in intron 1 and intron 2?
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) 1) A silent mutation that is also a transition
The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
pen+ GEAR Normal DNA Normal RNA Amino Acids Mutant DNA Mutant RNA: Name: FRAMESHIFT MUTATIONS occur when a base is added (or removed) from 8. Determine the amino acid chain coded for by the following sequence. Supp another A is added after the first codon. Complete the chart showing the amir normal and mutant sequence. Amino Acids Investigation: DNA. Proteins. and Mutatic TGG AGT CGA GGT TGG AAG TCG AGG T Why are frameshift mutations likely to cause more problems than a p 9. Cystic fibrosis is a disease that causes mucus to build up in th misshapen protein in the cell membrane which interferes with the popociated with the disorder
In each problem the DNA Triplet code is given. Determine the mRNA codon using base pairing and write the mRNA CODON into the blank. Using the mRNA CODON you identify in each problem and using the amino acid chart on the next page, identify the corresponding 3-letter amino acid (abbreviation) to place in each amino acid blank. 1. AAC (DNA TRIPLET) = _______(mRNA CODON) = _________ AMINO ACID2. TCG (DNA TRIPLET) = _______ (mRNA CODON) = _________AMINO ACID3. CTT (DNA TRIPLET) = _______ (mRNA CODON) = _________ AMINO ACID 4. GGT (DNA TRIPLET) = _______ (mRNA CODON) = _________ AMINO ACID
Table 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last Nucleotide of Codons The Amino Acids A UU phe phe leu leu Abbreviations Names UC gly glycine ser ser ser ser UA tyr tyr term ala alanine term val valine UG cys cys term trp ile isoleucine leu leucine CU leu leu leu leu ser serine CC pro pro pro pro threonine proline aspartate glutamate lysine arginine thr CA his his gin gin pro asp glu lys CG arg arg arg arg AU le ile ile met AC thr thr thr thr arg asparagine glutamine cysteine methlonine asn AA lys lys asn asn gin AG ser ser arg arg cys met GU val val val val trp phe tryptophan phenylalanine tyrosine histidine GC ala ala ala ala tyr his GA asp asp glu glu GG gly gly gly gly term termination 3. Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space provided. If the letters code for more than one amino acid, separate the names by dashes. b. UUA: c. GAG: d. UAUCUA: e. AUCUUG: f. AAGAGUUCG: g. AAAUUUGGG: h.…
If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.