5. Regulation of bacterial operons by inducers, e.g. lactose, exhibits which of the following properties? Inducer binds to the Inducer effect on RNA polymerase binding to the promoter Enhances Enhances Repressor produced by: repressor and: A. Activates the repressor B. Activates the repressor C. Activates the repressor D. Inhibits the repressor E. Inhibits the repressor A separate gene Genes of the operon A separate gene Genes of the operon A separate gene Inhibits inhibits No effect 6. Gene transcription rates and mRNA levels were determined for an enzyme that is induced by a newly developed drug. Compared with untreated levels, drug treatment caused a 10x increase in the gene transcription rate and a 20x increase in both mRNA levels and enzyme activity. These data indicate that a primary effect of the drug treatment is to decrease which one of the following? A. The activity of RNA polymerase B. The ability of miRNA to act on mRNA C. The rate of translation D. The rate of binding of ribosomes to mRNA E. The rate of transcription initiation by RNA polymerase 7. Increase of which of the following will result in a left shift of oxygen dissociation curve? A. Concentration of proton B. Concentration of carbon dioxide C. Concentration of 2,3-BPG D. pH E. Temperature 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach tissues? A. Histidine B. Aspartate C. Asparagine D. Glutamine E. Serine 9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of the region of an mRNA that contains the initial codon for translation of a protein with 300 amino acids? A B

Biology (MindTap Course List)
11th Edition
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Chapter14: Gene Regulation
Section: Chapter Questions
Problem 13TYU: INTERPRET DATA Develop a simple hypothesis that would explain the behavior of each of the following...
icon
Related questions
Question
5. Regulation of bacterial operons by inducers, e.g. lactose, exhibits which of the following
properties?
Inducer effect on RNA polymerase
binding to the promoter
Inducer binds to the
Repressor produced by:
repressor and:
Activates the repressor
A.
Activates the repressor
A separate gene
Genes of the operon
A separate gene
Genes of the operon
A separate gene
Enhances
В.
Enhances
Activates the repressor
D. Inhibits the repressor
Inhibits the repressor
С.
Inhibits
inhibits
Е.
No effect
6. Gene transcription rates and mRNA levels were determined for an enzyme that is induced by a
newly developed drug. Compared with untreated levels, drug treatment caused a 10x increase in
the gene transcription rate and a 20× increase in both mRNA levels and enzyme activity. These
data indicate that a primary effect of the drug treatment is to decrease which one of the
following?
A. The activity of RNA polymerase
B. The ability of miRNA to act on mRNA
C. The rate of translation
D. The rate of binding of ribosomes to mRNA
E. The rate of transcription initiation by RNA polymerase
7. Increase of which of the following will result in a left shift of oxygen dissociation curve?
A. Concentration of proton
B. Concentration of carbon dioxide
C. Concentration of 2,3-BPG
D. pH
E. Temperature
8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach
tissues?
A. Histidine
B. Aspartate
C. Asparagine
D. Glutamine
E. Serine
9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of
the region of an mRNA that contains the initial codon for translation of a protein with 300 amino
acids?
В
5' AGATGCCCTAAGGTCATTGTT 3'
3' TCTACGGGATTCCAGTAACAA 5'
C
D
А. А
В. В
С. С
D. D
E. None of the above
Transcribed Image Text:5. Regulation of bacterial operons by inducers, e.g. lactose, exhibits which of the following properties? Inducer effect on RNA polymerase binding to the promoter Inducer binds to the Repressor produced by: repressor and: Activates the repressor A. Activates the repressor A separate gene Genes of the operon A separate gene Genes of the operon A separate gene Enhances В. Enhances Activates the repressor D. Inhibits the repressor Inhibits the repressor С. Inhibits inhibits Е. No effect 6. Gene transcription rates and mRNA levels were determined for an enzyme that is induced by a newly developed drug. Compared with untreated levels, drug treatment caused a 10x increase in the gene transcription rate and a 20× increase in both mRNA levels and enzyme activity. These data indicate that a primary effect of the drug treatment is to decrease which one of the following? A. The activity of RNA polymerase B. The ability of miRNA to act on mRNA C. The rate of translation D. The rate of binding of ribosomes to mRNA E. The rate of transcription initiation by RNA polymerase 7. Increase of which of the following will result in a left shift of oxygen dissociation curve? A. Concentration of proton B. Concentration of carbon dioxide C. Concentration of 2,3-BPG D. pH E. Temperature 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach tissues? A. Histidine B. Aspartate C. Asparagine D. Glutamine E. Serine 9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of the region of an mRNA that contains the initial codon for translation of a protein with 300 amino acids? В 5' AGATGCCCTAAGGTCATTGTT 3' 3' TCTACGGGATTCCAGTAACAA 5' C D А. А В. В С. С D. D E. None of the above
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps

Blurred answer
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Biology (MindTap Course List)
Biology (MindTap Course List)
Biology
ISBN:
9781337392938
Author:
Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:
Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax