34. Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’-TATGGCATAC-3’
Q: The following represents a DNA strand in the process of replication. The bottom sequence is that of…
A: DNA replication is the process in which a copy of already existing genome is formed. A pair with T…
Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…
A: DNA polymer: 3'- CAG TTA AGG CTC CTA GGT TA - 5' a) first 5 bases at the 3' end of the…
Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTRY by Smith 4th Edition
A: DNA is the genetic material that carries genetic material in the form of coded nucleotide sequences.…
Q: 1. If 30% of DNA is Adenine, what percent is Thymine?
A: DNA ka double helical structure that consists of sugar phosphate and bases. the sugar that is…
Q: 13. What is the complimentary sequence of the following strand? CCCCTTAGGAACC? a. CCCCTTAGGAACC b.…
A: Nucleic acids are biopolymers formed of repeating units of monomers called nucleotides. There are…
Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…
A: The genetic material in most organism is double stranded DNA with the two strands running in…
Q: .1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…
A: The Chargaff’s rule state that the quality of the nitrogenous base pairs in the DNA is always equal.…
Q: 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'
A: DNA sequencing is the biochemical method used for determining the order of nucleotide bases, A, G,…
Q: 28. Structure of DNA is shown. What are the bonds between 2 nitrogenous bases? A::: P TC A T G A a.…
A: The given diagram represents Watson and Crick model of double helical structure of DNA . DNA helix…
Q: 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA…
A:
Q: Give at least two differences between prokaryotic and eukaryotic DNAs
A: Prokaryotic cells do not possess membrane bound organelles and nucleus whereas, eukaryotic cell…
Q: 1. Explain why the primary structure sequence -Lys-Leu-Trp-Asp- may promote a-helix formation while…
A: The formation of α helix is occurred due to attachment of H of N of Cα of first (n) amino acid to…
Q: 6. Write a brief paragraph each to explain what an insertion sequence and a transposon are. 7. What…
A: 1. Inclusion arrangements (Insertion sequences) (ISs) are little bits of DNA which move inside or…
Q: 7. How many hydrogen bonds exist between this DNA strand and its complementary strand?…
A: The DNA strand is a double helical strand which consists of two strands that run in an anti-parallel…
Q: 2. Provide the sequences of the template and coding strands of a DNA double helix that was used to…
A: The RNA or ribonucleic acid is produced from the DNA by the transcription process. RNA is used for…
Q: A+ AT D THA E 1. Identify a nucleotide of DNA. 2. Identify the labelled deoxyribose sugar. 3.…
A: Hi, Thanks For Your Question. Answer : 5 And 6 Are Answered Here, Rest Labelled in Diagram.…
Q: If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary…
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 9.)Which of the following does NOT describe the molecular structure of (DNA) Deoxyribonucleic Acid?…
A: 9- DNA is a double helix ,deoxyribose sugar made up of nitrogenous bases while RNA is ribose sugar.…
Q: 8 How natural processes can change the information stored in DNA?
A: Genetic information is stored in the chemical structure of DNA molecule. DNA molecule contains two…
Q: 8. Shown below is a DNA strand. 5' GACGTACTACGACTATGGC 3' What is the correct representation of its…
A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is a genetic…
Q: 25. Which sequence includes RNA that's complementary to the DNA sequence 5'-TATTCGC-3'? (Hint: in…
A: Adenine(A) and guanine(G) are purines ; cytosine(C) and thymine(T)/uracil(U) are pyrimidines , both…
Q: 7. Which of the following best characterizes the events that occur at an origin of DNA replication?…
A: Replication is the process of duplication of individual strands of a double stranded DNA. The…
Q: In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where…
A: These grooves arise in DNA molecules because the glycosidic bonds of a base pair are not…
Q: 8. For each of the following DNA template strands a. 3' TACGGC 5' b. 3' CCATTA 5' Determine: a. the…
A: The heterogenous nuclear ribonucleoprotein (hnRNP) is the initial step of synthesizing mRNA during…
Q: 19. You have reasonably short, typical, double stranded DNA sequence. Basically how many proteins…
A: DNA's molecular structure is referred described as a "double helix." Two connected strands that…
Q: 0. The two strands of DNA that make up the double helix are held to each other by … a)…
A: The correct option is A hydrogen bonds between guanine / cytosine, and thymine / adenine
Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…
A: Codons are the mRNA triplet nucleotides and are the coding sequences. They are translated to form a…
Q: 7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA…
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polymeric molecules essential in various…
Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer.…
A: DNA It is a nucleic acid that constitutes two polynucleotide chains that are complementary in…
Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: 9- Considering the structure of double-stranded DNA, which kind(s) of bonds hold one complementary…
A: Deoxyribose Nucleic acid (DNA) is the basic genetic material of life. It is made up of two strands…
Q:
A: Purines is equal to pyrimidines. So A=T C=G
Q: 3. Give the different hydrolytic products of : a. DNA b. RNA
A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…
Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…
A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…
Q: if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the…
A: DNA or Deoxyribonucleic acid is the genetic material which passes from one generation to another.…
Q: 4) Replication of a circular DNA molecule can occur by either theta replication or by rolling circle…
A: Circular DNA - Circular DNA is a kind of DNA that is in the form of loop. Circular DNA has no free…
Q: 6. H₂C HO Which of the following dinucleotides can be methylated by DNA methyltransferase? NH₂ NH₂ 9…
A: Since you have asked multiple questions, we will answer only first question for you. In order to get…
Q: 6. If you are given the DNA sequence: T-A-C-C-G-A-A-T determine the complementary RNA strand.
A: Introduction :- The term "DNA sequencing" refers to a common laboratory procedure for determining…
Q: List the DNA strand sequence complementary to the template strand.…
A: DNA contains Adenine thymine, cytosine, and Guanine. Whereas in RNA the Thymine is replaced by…
Q: 40) What external factor (aka, damaging agent) gives rise to the following DNA mutations? Write and…
A: Multiple questions with three parts are asked. I will answer for the question A , as per guidelines.…
Q: 14. For the diagram at right, please label the following words on the diagram. (A) Deoxyribose…
A: Note - Since you have asked multiple questions, we solving the first three for you. Please post the…
Q: (1) Describe the nitrogenous base pairing in DNA and RNA. (2) Determine the number of bonds in each…
A: DNA and RNA are polynucleotides. Monomers of nucleic acids are nucleotides. Nucleotides are made up…
Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…
A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a…
A: Answer is option 1 Explained in paper pen format in step 2
Q: 1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP…
A: AP endonuclease : It is an enzyme which is involved in the DNA base excision pathway The main…
Q: 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: The base pairing rule of DNA is purine always pairs up with pyrimidine. Adenine(A) and Guanine(G)…
Q: Regarding the triple DNA code, which of the following statements is true?
A: The genetic code refers to the set of rules that all living organisms use to encode information,…
34.
Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence:
5’-TATGGCATAC-3’
Step by step
Solved in 2 steps
- 34. Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing should be flat; do not draw the twist of the helix. Be sure to include the 5’-P, 3’- OH, deoxyribose sugar rings (with carbons 1’-5’ and the O indicated), and a simplified phosphodiester bond (O-P-O). Show purines as two differently-sized rings and pyrimidines as one ring and show the correct number of hydrogen bonds between bases. The dsDNA must be antiparallel. Drawing a simplified version of dsDNA will help you gain a better understanding of the concepts underlying dsDNA structure. It will most likely take a couple of tries to get a clear figure.789.If one DNA single strand has the sequence 5'-AATGCAA-3', what is the sequence of its complementary strand?Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'
- 47. Is the following a polymer of DNA or RNA? Explain how you can determine this. (Give two pieces of evidence). Label 3' and 5' ends. was CH₂ H 4 H 0 OUP-O 00 \5' 4 H H OH CH₂ H 3₁ 7 N S N 1' H 0 0=P-Q 4 5 H H- CH₂ OH H H 0=P-0₁ guanine NH ₂ N-H H OH uracil NH₂ H cytosine 04 03For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandIf one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite it on the other strand? Enter the complementary sequence of letters separated by hyphens. • View Available Hint(s) 3'- 3'-G-A-T-C-G-C-A-A-T-5' -5'
- 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and label the polarity (the 5’ and 3’ ends)5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5'-GGCAACGGTCCAGTCCAAGTTACG-3' 6. What are the amino acids coded for by this sequence of nucleotides: ATG GGA ACT CCA 7. What is the complementary messenger-RNA sequence for the DNA sequence shown below? ATC GGA CCG ATT GCCWrite the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAA