Answered: If one strand of DNA has the sequence…

If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite it on the other strand? Enter the complementary sequence of letters separated by hyphens.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 15QP: Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw...

See similar textbooks

Related questions

Q: If the nucleotide sequence of one strand of DNA is 5′ ACGTTGCA 3′, what is the sequence of the…

A: In molecular biology, the DNA is made of two complementary strands which runs antiparallel to each…

Q: What sequence of bases on one strand of DNA is complementary to the following sequence on another…

A: Complementary bade pairs It is the phenomenon where in DNA Guanine always hydrogen bonds to…

Q: A particular triplet of bases in the coding sequence of a DNA strand is AGT. What is the…

A: Most of the animals have ‘Deoxyribonucleic acid’ (DNA) as their genetic material. Some lower…

Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…

Q: How does the 5' end of a DNA strand differ from the 3' end?

A: DNA and RNA are nucleic acid or biopolymer which consists of monomeric units called nucleotides.…

Q: If you are given the DNA sequence: T-A-C-G-G-T-C-A, determine the complimentary DNA strand.

A: DNA is the molecule which stores the genetic information in an organism that makes the nucleotide,…

Q: If one strand of DNA has the sequence A-A-C-T-G-T-G, what will be the nucleotide sequence of the…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Which type of base pairs take the most energy to break in a DNA double helix? a. A-T base pairs b.…

A: DNA replication is a process in which DNA makes copies of itself with the help of the enzyme DNA…

Q: Which of the following combinations are true of the nucleotide composition of a sample of DNA?…

A: Deoxyribonucleic acid (DNA) is the chemical name for the molecule that carries the genetic…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…

Q: If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became…

A: A point mutation or substitution is a form of genetic mutation where a 1 single nucleotide base is…

Q: If one DNA strand is 5′–GATTCGTTC–3′, what is the complementary strand?

A: Complementarity in the strands of DNA is referred to as a lock-and-key relationship between both the…

Q: What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to…

A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that has all the stored genetic…

Q: H. HD N. A N- H- H. 0=P-0- CH2 H. H. H. OH) H B. Where would this nucleotide hydrogen-bond to its…

A: Each nucleotide is a monomer of nucleic acid such as RNA and DNA. The RNA and DNA differs from each…

Q: Given the following strand of DNA: 5' CATAGCCTTA 3' Which of the following sequences is the…

A: DNA and RNA are nucleic acids present in organisms. DNA is the deoxyribose nucleic acid whereas RNA…

Q: Which of the following relations will be true for the percentage of bases in double-stranded DNA? a.…

A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: If a double-stranded DNA molecule is 15% thymine, what are the percentages of all the other bases?

A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…

Q: Which structural feature of DNA is shown in the figure marked as "X"? (A

A: Introduction A DNA molecule consists of two strands that wind around each other like a twisted…

Q: Match the label on the left with the correct structure number in the DNA molecule in the image…

A: The given structure is of a alpha helix DNA. The DNA is composed of nucleotides. Nucleotide - The…

Q: Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base…

A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA are:…

Q: If the sequence T-A-C-C-C-T appears on the informational strand of DNA, what sequence appears…

A: DNA is a deoxyribose sugar nucleic acid that carries genetic information from one generation to…

Q: Which one of the three parts to a nucleotide is used to determine the 5' to 3' direction of a DNA…

A: A consequence of the structure of nucleotides is that a polynucleotide chain has directionality –…

Q: What type of bond is the arrow pointing to in this image of DNA? -Hydrogen Bond -Covalent Bond…

A: DNA is a molecule that was discovered in the late 1860s by Friedrich Meischer in the nucleus but its…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…

A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…

Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…

A: A complementary strand of DNA is constructed based on base complementarity. Complementarity is…

Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…

A: Answer

Q: If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following…

A: DNA is the double stranded structure. Both strand is antiparallel to each other, direction of one…

Q: If one strand of the DNA double helix consists of T-C-G-A-T-G-T-A, what is the sequence of the…

A: Introduction DNA ( Deoxyribonucleic acid) and RNA( ribose nucleic acid). These are the nucleic acids…

Q: If a DNA strand has the nucleotide sequence of CCGAGATTG, what is the nucleotide sequence of the…

Q: If one of the strands of DNA has the following sequence of bases running in the 5-S3'…

A: The given strand is: 5'-G-G-A-C-A-A-T-C-T-G-C-3` The complementary strand for the given sequence is:…

Q: 1. Phosphate 2. Ribose sugar 3. Deoxyribose sugar 4. Uracil 5. Thymine 6. Adenine 7. Guanine 8.…

A: Adenine is the nucelotide which join to the deoxyribose sugar and binds to the thymine nucleotide

Q: in DNA replication, if the template strand is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: DNA strand is made up of 4 nitrogenous bases i.e adanine, thymine, guanine & cytosine.

Q: Given is a strand of DNA, fill in the corresponding RNA strand and find which amino acids that…

A: Introduction The process of converting a piece of DNA into RNA is known as transcription. Messenger…

Q: Indicate the correct base order for the complementary DNA strand by placing the correct label in…

A: A DNA strand is formed of nitrogenous bases also called nucleobases. There are 4 nucleobases viz.…

Q: What is the complimentary DNA sequence to the strand below? C-G-G-T-T-A-G

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…

Q: Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Draw the complementary…

A: Let us first understand the one letter codes for the given nucleotides: A is Adenine T is Thymine…

Q: A small segment of DNA has the following sequence: A – A – T – C – T – C – G – T – A The sequence…

A: DNA is a molecule composed of two polyneuclotide chains coiled around each other in a helical…

Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…

A: Complementary strands are two chains of DNA that make up the double-helical structure of DNA. The…

Q: Match the correct bases pairs to find the opposite strand of DNA strand of DNA - T G C…

A: DNA is deoxyribonucleic acid. It is the genetic material which is double stranded, which means it…

Q: Why do you think it is important that the sugar-phosphate backbone of DNA be held together by…

A: DNA is made up of nucleotides. Nucleotides contain three units- a pentose sugar, a phosphate group,…

Q: A strand of DNA has the specific sequence ATGGCTA. What would be the sequence of a complimentary…

Q: If the template strand of a DNA is 3’-ATCATG-5’, what will be the complementary strand?

A: A nucleotide is a bio molecule that consist of a nitrogenous base, a pentose sugar (deoxyribose in…

Q: If a double stranded DNA molecule is 20% thymine, what are the percentages of all other bases? 1.…

Q: orange G (yellow) bromophenol blue (purple) xylene cyanol (blue)

A: Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins…

Q: Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence:…

A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…

Q: If you have a strand of DNA that is GAGATCTCGC , what is the complimentary strand?

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: If I have a strand of DNA that has the base pairs as below, what would the base pairs be on the…

A: Adenine complements with thymine and cytosine complements with guanine in a DNA strand. According to…

Question

If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would
appear opposite it on the other strand?
Enter the complementary sequence of letters separated by hyphens.
• View Available Hint(s)
3'- 3'-G-A-T-C-G-C-A-A-T-5'
-5'

Expert Solution

Introduction

DNA is the genetic material that involves the transfer of information from one generation to the other. Any changes in the DNA result in the generation of a new trait. Thus, DNA plays a major role in evolution. DNA is the genetic material for all living organisms whereas RNA is the genetic material in viruses. DNA is made up of four nucleotides namely adenine, guanine, thymine, and cytosine whereas RNA consists of adenine, guanine, uracil, and cytosine.

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

The complementary sequence for the strand given below is 5' AUU CCU CCC AAU AUG 3' O 5 CAUAUUGGGAGGAAU 3 O 5' UAAGGAGGGUUAUAC3' O 3' GUAUAACCCUCCUUA 5' O3' AUU CCU CCC AAU AUG 5'
5' G-A-T-A-с-А-А-с-А-т-G-6-A-с-А-т-G-А-с-т3 What would be the first 3 bases in the 5' end of the complementary strand? Indicate the base sequence and the direction of synthesis of a 3-nucleotide RNA primer. Indicate the base sequence and the direction of synthesis of a 5-nucleotide Okazaki fragment (include a 3 nucleotide RNA primer, a total of 8 bases in the sequence). Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair and G-C base pair?
Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'
If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.
Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Draw the complementary RNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3'
The DNA sequence you use will be the following: T - A - G - C - C - A. You will need to make the complementary strand - fill in the table below with the complementary base pairs (remember Chargaff’s rule: A = T and C = G) 5’ T A G C C A 3’ 3’ 5’
What is the term applied to the trinucleotide shown by the arrow? 5' Py U AU AGGCC G C G ACCACCUGe
What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.
wol for Frayon Elolog - Meet - cha-gX-m sc Jupiter Ed G Which orgerell= A sample of DNA is collected from an organism. It is analyzed and determined that 20% of the DNA is made up of the base adenine. Based on this information, which of the following correctly lists the amounts of the three. remaining bases for this sample? 10% cytosine, 30% thymine, 40% guanine O 20% cytosine, 20% thymine, 20% guanine 30% cytosine, 30% thymine, 20% guanine 30% cytosine, 20% thymine, 30% guanine p. 5 of 31
If the recognition sequence of the restriction enzyme HindiIl is AAGCTT, then how many covalent bonds will be broken by the enzyme in the following DNA molecule? 5'-T-C-A-A-G-C-T-T-C-G-A-A-G-C-T-T-G-A-3 3-A-G-T–T-C-G-A-A-G-C -T-T-C-G-A-A-C-T-5 А. 1 В. 2 С.3 D. 4
Consider the following DNA sequence: -T -- -- If RNA primase used this section of DNA to make a primer, what would be the correct sequence of base pairs (from top to bottom)? T-A-C-C-G-T-T OT-U-C-C-G-U-U OA-T-G-G-C-A-A U-A-C-C-G-U-U
Draw the following strands of DNA5’ C-A-T 3’ as well as the complementary base pairing strand hydrogen bonded to itIt should be drawn in detail, structurally.