3. Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart in your book. (For A and B) A. TAC CTA GCG CAC ATG TAG GTG GGC AAA GTT MRNA sequence: AMINO ACIDS: B.TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG MRNA Sequence Amino acids: 4. Would your answer be any different if I give you same human DNA sequence instead of bacterial DNA sequence? Why or Why not? 5. Why are there codes for "start" and "stop"?

3. Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart in your book. (For A and B) A. TAC CTA GCG CAC ATG TAG GTG GGC AAA GTT MRNA sequence: AMINO ACIDS: B.TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG MRNA Sequence Amino acids: 4. Would your answer be any different if I give you same human DNA sequence instead of bacterial DNA sequence? Why or Why not? 5. Why are there codes for "start" and "stop"?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU 3'
3. Using your Genetic Code, translate and group the following mRNA bases. Example: UAC CAG UGG UUU CUA AUC Your Answer: AUG GUC ACC AAA GAU UAG Met – Val - Thr- Lys – Asp - Stop 5' CUCGGUACGUAAUAGAUCUAUCAUCC GAGACUCUUAAAU 3 b. 5' CUAAUAUUGUGAGAU 3'
thank you
1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids expected in the final protein (using the MRNA codonstable): DNA TAC CGC TCC GCC GTC GAC AAT ACC ACT MRNA Amino Acid DNA TGA C АTG ATC MRNA AUG ACU AGC UGG GGG UAU UAC U00 UAG Amino Met Ser Trp Tyr Phe Acid DNA TAC CAC CGT ATG GCT GGG AAT ATC MRNA Amino Acid
2. Given a DNA template molecule of 5' - ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence and then the polypeptide sequence, starting at the first start codon. mRNA: 5'- CCAU AUG UUA ACU AGU AGG UAG GAG CCA U - 3' Polypeptide: (N) Met-Leu - Thr - Ser - Arg (C)
5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCG
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution
(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?
Format Tools Table Window Help dit View Insert A A SU E D - Expression activities (1 Com Design Layout >> Tell me Sare Commen Insert Draw Font Paragraph Styles Dictate Sensitivity For each example, fill in the template strand DNA sequence, mRNA codons, tRNA anticodons, or amino acid sequence. If several sequences might work choose any one. Use the figures in your book for cross mapping. Answer the questions on the second page on a separate paper. 1. DNA MRNA AUG АCU A G C U G G G G G UAU U A C UUUUAG tRNA AA 2. DNA TAC C GC T C C G C C GT C GACA A T A C C ACT MRNA tRNA AA 3. DNA MRNA tRNA UA C CAC C Cc C GU AUG G CU A AU A UC G G G AA 4. DNA MRNA TRNA AA МЕТ ARG GLY PHE PHE МЕТ VAL GLY (STOP
From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed