1. What are the new DNA sequences and the corresponding new amino acid sequences of these two mutations? (2 answers: 1 for T-deletion; the other for G-insertion.
Q: The _____________ of hemoglobin is defined as the ratio of hemoglobin with bound oxygen to total…
A: Introduction The oxygen-hemoglobin dissociation curve, also known as the oxyhemoglobin dissociation…
Q: Based on the group it belongs to, which land plant innovations are possessed by Dicranum scoparium…
A: Introduction Vascular plants, otherwise called Tracheophyta, structures an enormous group of plants…
Q: The degeneracy of the Genetic code is due to A. a 1 to 1 correlation between single amino acids and…
A: The production of polypeptide chain (proteins) from the mRNA is known as translation that occurs…
Q: When is gelatin used in culture media preparation?
A: Gelatin is a protein with a consistent molecular structure that is mostly produced by the…
Q: Glycolysis Pyruvate Oxidation Citric Acid Cycle Oxidative phosphorylation Total Molecules produced…
A: Cellular respiration involves breakdown of glucose and production of energy in the form of ATP. In…
Q: Why do some viruses infect only animals and others only humans? How do viruses overcome these…
A: Viruses are ultrasmall pathogenic pathogens which can only grow inside a host cell. The viruses can…
Q: Which of the following statements related to the Calvin Cycle is CORRECT? Six molecules of G3P are…
A: Calvin cycle is the part of photosynthetic reactions, where carbon is fixed into sugar. This…
Q: Write a detailed account of how the body monitors blood pressure with baroreceptors and how the…
A: Introduction: Baroreceptors is a type of mechanoreceptor that allowing for the relay of…
Q: Mutants were isolated in which the constitutive phenotype of a missense lacl mutation was…
A: In an experiment, the mutants were isolated in which the constitutive phenotype of a missense lacI…
Q: Which among the following statements is CORRECT? The thylakoid membrane, in the chlorophyll,…
A: Introduction Stroma is important as it consists of enzymes required for the fixation of carbon…
Q: citrate cycle
A: Citric acid cycle: It is also known as TCA cycle or Kreb's cycle. It is a series of chemical…
Q: Which statement best describes the interaction that occurs as a result of the bindi ligand to a…
A: Option- B
Q: The amount of DNA per cell of a particular species is measured in cells found at various stages of…
A: Cell division is a phenomenon in which parent cell undergo splitting and give rise to novel cells.…
Q: ne the phenotypes of grande and petite yeast cells with respect to the extraction of cell energy…
A: In the realm of genetics, Saccharomyces cerevisiae, or bread mould, is actively researched. The…
Q: what is the mRNA Sequence? ATC GG ATACAAT
A: DNA and RNA are nucleic acids that are found in living cells. Almost all living cells contain both…
Q: Use the concept of an LD50 value. The LD50 of a substance is the dosage that would be lethal to 50%…
A: Acute toxicity refers to the adverse effects of a tested chemical substance that is the outcome of…
Q: Give an example of an anaerobic traning exercise program using the FITT Principle
A: FITT PRINCIPLE: It is a method to create a perfect workout plan. It is presented with a structure…
Q: this is an example of biotechnology: In order to increase the yield of oil from canola, research…
A: Biotechnology is the branch of science that deals with the production of various products by using…
Q: Humid continental and humid subtropical climates both feature deciduous forest biomes. A major…
A: A biome, often referred to as life zones or the dwelling places of life, is made up of all the…
Q: Name the chromene rich plants located in India (minimum 10) and their common name.
A: Chromene or Coumarin is utilized in the pharmaceutical business to take anticoagulants. Coumarins…
Q: In the mismatch repair pathway, DNA damage is recognized by
A: DNA mismatch repair pathway in short known as MMR. It recognizes and repairs base to base mismatch,…
Q: What is production
A: Ecology The study of interactions between living things, such as humans, and their natural…
Q: What is energy cycle
A: The energy is the main thing that made the earth suitable for life. Every living organisms need…
Q: Melvin, ace biology student, is m hypertonic" and "hypotonic" mean. Melv nembrane. The figure shows…
A: Hypertonic hypotonic and isotonic solutions are solutions which refers to the tonicity or a measure…
Q: 82 81 83 80 O 79 78 75 76 77
A: Leeches have segmentation, they are parasitic or predator insects which belong to the order…
Q: The genus Homo dates back to about____. a. 3.9 million years ago b. 1.8 million years ago c. 250,000…
A: At some point between 3.0 and 2.5 million years ago, the genus Homo first appeared . The Homo…
Q: Insulin is a hormone that regulates the concentration of glucose in the circulatory system by…
A: Insulin is a hormone that is produced by the beta cells of islets of Langerhans in the pancreas.…
Q: GLUT4 is a protein channel that facilitates the transport of glucose into the cell. Under nor- mal…
A: The beta cells in the pancreatic cells create the peptide hormone insulin. It serves as the body's…
Q: The figure below represents the relative amount of nuclear DNA during different segments of…
A:
Q: Based on similarities among forelimbs, what bones did the common ancestor of tetrapods probably…
A: Introduction : Homologous organs are those organs that have a common origin but different functions.…
Q: These are two paper the question start from the table.
A: Osmosis is the process of movement of water from the high-water potential to low water potential…
Q: Record your KIA results below. Indicate the color of the slant and butt (Yellow/Red/Fuchsia),…
A: Klinger's Agar is the differential medium used for the identification of the organism's abilities to…
Q: Assuming that the mean size of the human sau3AI partially digested fragments clones is 3kb,…
A: Human sau3AI is a tool used to help predict and diagnose disease. It is a blood test that looks for…
Q: A researcher examining a root tip observes a plant cell with condensed daughter chromo- somes at…
A: Root tip mitosis is the first stage of cell division in the root of a plant. The root tip is where…
Q: How are vesicles with neurotransmitter transported to the synaptic cleft? A. Retrograde, slow…
A: Nervous system is a body system which is involved in transmission of impulse, control as well as…
Q: Many common medications function by interrupting the normal operation of certain signal transduction…
A: Inside the cell, multiple signaling pathways run simultaneously that allow the cell to communicate…
Q: Resident ER proteins destined to remain in the lumen of the ER are marked by retrieval sequences and…
A: The "Endoplasmic reticulum(ER) plays an important role, and it is where the membranes and their…
Q: What kinds of legal issues do you think stem cell research and genetic therapies will present int he…
A: Nowadays stem cell research can offer some big opportunities to understand the basic mechanisms of…
Q: Hormones are chemical signaling molecules produced by specialized cells and transmitted via the…
A: A hormone is a class of signaling molecules found in multicellular creatures that are transmitted to…
Q: All of the following regarding ribosomes are true EXCEPT: A. Ribosomes are comprised of protein and…
A: The answer is option c. All of the following regarding ribosomes are true EXCEPT ribosomes bind…
Q: The procedure to find the mechanism through which bacterial genetic material may withstand…
A: Bacteria is a prokaryotic organism and consists of circular double-stranded DNA. They have single…
Q: Why is it necessary to inoculate the KIA medium all the way down to the bottom of the tube during…
A: Answer : it is necessary to inoculate the KIA medium all the way down to the bottom of the tube…
Q: The first hominin thought to migrate out of Africa was____. a. P. boisei b. Homo habilus c. Homo…
A: Our ancestros started to move northwars and spread all over the world after leaving their homeland,…
Q: Is each of these statements true of chloroplast or mitochondrial genomes, both, or neither?…
A: Instructions for making the molecules known as tRNAs are provided by the genes in the tRNAs…
Q: In your own words, give the components of the following body system and the functions of each…
A: The respiratory system is the organs and other parts of our body involved in breathing, when we…
Q: mRNA maturation in eukaryotes includes all of the following EXCEPT: A. Topoisomerase activity B.…
A: In eukaryotic cells, the primary transcript undergoes post transcriptional modification to form a…
Q: Which of the following innovations preceeded the relevant scientific breakthrough?…
A: A scientific breakthrough is always supported/started with a hypothesis backed by quantitative…
Q: Which of the following embryological events is involved in the formation of the ovarian follicles?…
A: Ovarian follicles are fluid filled follicles present in ovaries which remains in first meiotic stage…
Q: Which female could be the mother of the child and why? Which male could be the father of the child…
A: There are several ways to identify the mother of a child from VNTR loci. One way is to look at the…
Q: All of the following are true about the design of the Beadle and Tatum experiment (one gene one…
A: The "one gene, one enzyme" theory was supported by George Beadle and Edward Tatum's demonstration…
1. What are the new DNA sequences and the corresponding new amino acid sequences
of these two mutations? (2 answers: 1 for T-deletion; the other for G-insertion.
Step by step
Solved in 2 steps with 1 images
- Second letter A G UCU UCC UAU. Tyr UAC. UUU1 Phe UUC. UUA UUG. UGC Ser }Leu UAA Stop UGA Stop UAG Stop |UGG Trp UCA UCG CAU His CUU CỤC CCU ССС ССА CGU CGC Arg Leu CÁCS Pro CỦA CUG CGA CAAGIN CGG, Gln CAG, CCG J AAU Asn ACU АСC АСА AUU AGU Ser AUC }le A AUA AAC. Thr А AGC AGA AUG Met | ACG ] AAG Lys AG. GUU GUC GCU GAU1 AAsp GACS Ala GAA GGU GGC GCC Val Gly GGA G GUA GCA GUG GCGJ GAG Glu GGG Which peptide is the least likely to be made on the ribosome and why? а. Third letter DUAG 5UAG DUAG DUAG First letterHindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)41 The initiation complex for translation includes transfer RNA-MET. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. TRUE FALSE
- The sequence below used the sequence in "1" and encountered a point mutation: TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT -TGG-AAT-GTG-CCA-AAG-TTG-CAG-TGA-AGG-TG A-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-AT G-AGA-TTT-CGC-CCC-CGA-TAC-GAT-TTG-CTG-A AT-AGA-CTC-GAT-GAA-TCG-CGC-GAT-GTT-ACT a. Determine the mRNA produced by transcription: USE "-" TO SEPARATE CODONS, NO SPACES) b. Determine the amino acid sequence after translation (USE TO SEPARATE AMINO ACIDS, NO SPACES): c. What is the type of point mutation that occurred?Which letter represents the target site of furosemide (Lasix)? E- -BIs a Primer written in the RNA or DNA form?
- 5’- TTGACATGCG ATGTCGTAGG GATATATAAT CCACACAGTC GACAATTGAC ATCCCGGTCA CCTATAATCG TGAACACATA TAAGGAGTCT GACTATGGTA AGTAAATATG GTCATTAGTT ATGTGAACAG CCATTGGAGT CCACACTGAC TGAGATTAAG AGATGCCGAT AAAGTGGATA GCATTTTAAC TTGACAATGG ACGATCGATC GTAATTACCA ATGTGAATCG TAGTTGCGCA TTTCGGACGT -3’ a) Counting from the first nucleotide (A) of the Shine-Dalgarno consensus sequence, show the sequence of the first 20 nucleotides in the mRNA encoded by this piece of DNA (specify 5’ & 3’ ends). b) What is the sequence of protein X (specify the amino and carboxyl termini)? c)A mutation occurs in the original DNA strand for protein X such that the adenosine nucleotide at position +35 is deleted. What is the effect of this mutation? d) A mutation occurs such in the original DNA for protein X strand such that the adenosine nucleotide at position +48 is changed to a thymine. What is the effect of this mutation?The sequence below used the sequence in "1" and encountered a point mutation: TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT -TGG-AAC-GTG-CCA-AAG-TTG-CAG-TGA-AGG-T GA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-A TC-AGA-TTT-CGC-CCC-CGA-TAC-GAT-TTG-CTG- AAT-AGA-CTC-GAT-GAA-TCG-CGC-GAT-GTT-ACT a. Determine the mRNA produced by transcription:BSE TO SEPARATE CODONS, NO SPACES) b. Determine the amino acid sequence after translation (USE" TO SEPARATE AMINO ACIDS, NO SPACES) C. What is the type of point mutation that occurred?TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT -TGG-AAC-GTG-CCA-AAG-TTG-CAG-TGA-AGG-T GA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-A TG-AGA-TTT-CGC-CCC-CGA-TAC-GAT-TTG-CTG- AAT-AGA-CTC-GAT-GAA-TCG-CGC-GAT-GTT-ACT a. Determine the mRNA produced by transcription: USE "-" TO SEPARATE CODONS, NO SPACES) b. Determine the amino acid sequence after translation (USE TO SEPARATE AMINO ACIDS, NO SPACES): c. What are the Start and Stop codons in the mRNA?
- EboV Strain 1 EboV Strain 1 (Circle the mutated bases) CCA TGT AAG TGG TTA mRNA ProteinDetection of viral RNA by RT-LAMP for detection SARS-CoV2 Write about the procedure1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate V