Resident ER proteins destined to remain in the lumen of the ER are marked by retrieval sequences and if these proteins are exported from the ER to the Golgi, they are recognized by a recycling receptor in the ERGIC or the Golgi and selectively returned to the ER. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a b True False

Resident ER proteins destined to remain in the lumen of the ER are marked by retrieval sequences and if these proteins are exported from the ER to the Golgi, they are recognized by a recycling receptor in the ERGIC or the Golgi and selectively returned to the ER. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a b True False

Name: Resident ER proteins destined to remain in the lumen of the ER are ma
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Resident ER proteins destined to remain in the lumen of the ER are marked by retrieval sequences and if these proteins are exported from theER to the Golgi, they are recognized by a recycling receptor in the ERGIC or the Golgi and selectively return

3-2-1 Code It

6th Edition

ISBN:9781337660549

Author:GREEN

Publisher:GREEN

Chapter8: Introduction To Cpt Coding

Section: Chapter Questions

Problem 5CPTS

See similar textbooks

Similar questions

What is the process for retrieving soluble, luminal ER proteins that "leak" out of the ER into the cis-Golgi? What would occur if this retrieval was not possible?
What type of experiment can be performed to confirm that the C-terminal KDEL tetrapeptide is both necessary and sufficient in ER localization? (Necessary meaning that without KDEL, ER retrieval would not occur, and sufficient meaning that with KDEL, we would definitely see its effect (ER retrieval would occur))
How do RER and SER differ from one another in terms of structure and function? List the processes in which the ER is involved.
Please help Olivia is an ER soluble resident protein that has ended up at the Cis-Golgi network. Explain: - Why this protein leaves the ER - Why it must be retrieved - How it is retrieved
If you were to remove the ER retrieval signal fromprotein disulfide isomerase (PDI), which is normally a sol-uble resident of the ER lumen, where would you expect themodified PDI to be located?
Members of the integrin family are the major cell surface receptors for many ECM proteins such as fibronectin. In experimental studies, single integrin heterodimers have been found to assume more than one structural conformation. Describe the relationship between integrin structures and their activities.
Transduction: Describe the process of generalized transduction as a type of horizontal transfer. In your response be sure to address the following:Outline the steps needed in transduction including an explanation of any terms (i.e. transducing particle).
Sec61 is a protein involved in the formation of the translocon for ER-targeted proteins.What would happen to the proteins targeted to the Golgi Apparatus in a mammalian cell in which the Sec61 is mutated?
What is the signal recognition particle composed of?
When challenged with a low oxygen environment, knownas hypoxia, the body produces a hormone called erythropoietin(EPO), which then stimulates red blood cell production tocarry more oxygen. Transcription of the gene encoding EPO isdependent upon the hypoxia-inducible factor (HIF), which is atranscriptional activator. However, HIF alone is not sufficientto activate EPO. For example, Wang et al. (2010. PLOS ONE 5:e10002) showed that HIF recruits another protein called p300to an enhancer for the EPO gene. Furthermore, deletion of p300significantly impaired transcription of the EPO gene in responseto hypoxia. Given that p300 is a type of histone acetyl transferase,how might p300 influence transcription of the EPO gene?
By means of a flowchart, show the possible jumps that a transposoncan make. Show the involvement of viruses in its movement.
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC AAGCTCGAGAGCAСCAGCTСТАТGCGСТАСТАТААТGAССАКТАТАСССТАCGTGATAG 5" 3' RNA promoter polymerase 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? 4b. What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' --- 4c. What are the first 5 amino acids encoded by this gene? )Note - there is a codon table available at the beginning of this exam. N' C' 4d. Will translation stop at the UAA which begins at position 41? Explain your logic 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new…