1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA Translation O Amino Acid Protein O Nucleus Codon

Q: A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a mutation…

A: Nonsense codon The mRNA sequences; UAA, UAG, UGA signals the termination of the process of…

Q: 9 The table opposite shows the standard riplet codes for the 20 amino acids involved in protein…

A: Transcription is the process in which the DNA strand which codes for a protein and e converted to…

Q: Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: Sequence of nucleotides in MRNA|AUGCGUUCAUGGACU Sequence of amino acids in protein

A: Sequence of nucleotide in mRNA  AUGCGUUCAUGGACU is given .

Q: the information stored in gene transferred to a similar molecule called RNA in the nucleus.…

A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…

Q: Which component is not directly involved in translation?(A) GTP(B) DNA(C) tRNA(D) ribosomes

A: Translation is the process by which polypeptides are synthesized from a mRNA transcript, which was…

Q: Which of these molecules would have the most monomers (i.e. be longest)? a) RNA polymer that…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: . Which of the following statements about the flow of genetic information is correct? A. Translation…

A: Genes are the basic hereditary molecules that carry hereditary information in them. They are present…

Q: The anticodons are located in a.tRNA. b.rRNA. c.mRNA. d.ribosomes. e.endoplasmic reticulum.

A: Anticodons- An anticodon is a trinucleotide sequence complementary to that of a corresponding codon…

Q: The process by which the genetic code of DNA is copied into a strand of RNA is called O translation…

A: Since we answer the first question in case of multiple questions. If you want any specific question…

Q: The strand of DNA contains the sequence of bases: CGA CCG TAC. What is the sequence of the…

A:

Q: 8. Label each figure with what TYPE OF CELL is undergoing gene expression: Nuclear membrane DNA…

A: Gene expression is a process in which first transcription occurs that is formation of RNA occurs…

Q: Which of the following is a function of TRNA? O A) brings one amino acid to the ribosome B)…

A:

Q: Match each statement below with the correct RNA molecule.   A. rRNA B. mRNA C. tRNA D. uRNA…

A: mRNA contains the codons in the form of triplet of nucleotides during transcription and is…

Q: 2. Use the MRNA sequence to find the DNA sequence and the amino acid sequence. DNA MRNA-…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…

Q: 8. Some antibiotics work by preventing protein synthesis in bacteria by binding to their ribosomes.…

A: Multiple choice answer is given below:

Q: Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene…

A: TRANSCRIPTION It is the process of transfer of sequence information from DNA  to RNA . The DNA…

Q: ion, mRNA codons, peptide bonds, nucleus.

A: The process of transcription to translation decides the fate of genetic material. Both of the…

Q: How many nucleotides are in 12 mRNA codons? a. 12 b. 24 c. 36 d. 48

A: The three-letter nature of codons means that the four nucleotides found in mRNA are A, U, G, and C.

Q: Which of the following is true about transcription? O transcription begins at a start codon and ends…

A: Transcription is the process of making RNA from the template strand of DNA. It takes place in the…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…

A: Thank you for the question  Answer :- The given picture shows translation termination Explanation :-…

Q: 2. Identify the following structures when given images such as the ones below: ● process of…

A: Introduction The cell is the basic structural and functional unit of life present in all living…

Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…

A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…

A: In the process of synthesis of proteins from DNA, the information in DNA is used for the synthesis…

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: Which process is illustrated in the diagram below? NNNNNNNNNNI Oa replication Ob.RNA processing Oc…

A: DNA synthesis inside the cell occurs when the cell decides to divide. DNA synthesis is carried out…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: 3. On the diagram below, draw how the mRNA is translated into a peptide beginning with the third…

A: This question we have to describe about process of translation.

Q: 6) The diagram shows a strand of DNA matched to a strand of messenger RNA. MRNA is being made from…

A: Francis crick proposed central dogma which gives the flow of genetic information from DNA to RNA to…

Q: 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA.…

A: The double-helical structure of DNA was transcribed into mRNA molecules and these mRNA molecules are…

Q: 2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT cCA CAG ACA * AGU…

A: Transcription is defined as the process of RNA formation from the template strand of DNA by the…

Q: what is the diagram depictin A) transcription and translation return B. DNA replication C -DNA…

A: Gene is a hereditary units that are present on the Chromosome. It contain genetic instructions . DNA…

Q: 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA.

A: 7. In all living organisms, the material that  contains  the information which is transmitted from…

Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…

A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…

Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…

A: The central dogma of molecular biology involves the processes of transcription and translation that…

Q: 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: In RNA, ___________ pairs with adenine. A.Group of answer choices cytosine guanine thymine…

A: RNA (ribonucleic acid) is a nucleic acid which consists of repeating units of ribonucleotides. A…

Q: 1. Decoding mRNA into amino acids is called translation.

A: above given statements are about transcription, translation process and how amino acids makes a…

Q: Which of the following molecules is used to transfer the genetic code from the nucleus to the…

A: Proteins are large biomolecules that play a significant role in the physiological activities of the…

Q: 3. Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart in…

A: Question 3 A) TAC CTA GCG CAC ATG TAG GTG GGC AAA GTT  m-RNA sequence: AUG GAU CGC GUG UAC AUC CAC…

Q: Discuss the difference between intron and Exon

A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…

Q: (6C) The diagram below shows the process of translation. protein moleçule forming Bead and re-read…

A: which of the following describe the role of the ribosome :

Q: 4. Which MRNA sequence complements the DNA sequence below? (LS1- 1) * A C SUP Sequence A O Sequence…

A: The DNA molecule in the cell stores the genetic information of the organism. But this information by…

Q: 4. A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a…

A: Mutation is any change in the sequence of DNA that causes a change in the protein that is…

Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…

A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: DNA ( Deoxyribonucleic acid ) is two stranded structure which functions as genetic material in most…