Worksheet+4+MCB110 2

Task 1: Compare the characteristics of DNA to RNA. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. DNA RNA No Answers Chosen No Answers Chosen DNA & RNA No Answers Chosen Possible answers Phosphate group | Cytosine Adenine Basic unit is the nucleotide Single strand Double helix E Phosphate-sugar backbone | Uracil | Guanine | Thymine :::: ::::

Task 3: Agarose Gel Electrophoresis Your amplicon from PCR was subjected to AGE for analysis. You are shown the image of the gel loaded with the following lanes: (A) negative control, (B) size ladder (1, 2, 3, 4, 6, and 10 kb), (C) gDNA extract, (D) PCR amplicon. However, due to mishaps while loading the gel with the samples, you are not sure which lane is which. You are shown a diagram of the obtained gel below.   a. b. Label each lane of the gel. Write only the corresponding letters in the wells above. Above each band in the size ladder, write its size (in kb). c.corresponding to the gene. Approximate the size (in kb) of the polystyrenase gene. Write your answer above the band Bonus: If you wish to identify the bacterial species in this scenario, what gene is most commonly and routinely sequenced?Answer: __________________________________

question on plasmid minipreps and restriction digestion What role does the combination of alcohol and salt play?

Post lab questions 1) The approximate length of a DNA double helix is around 0.34nm per base pair. If the extracted DNA was in the form of a single double helix, calculate how long it would be in meters. (1nm = = 10-⁹m) Clear All Formatting 2) How long would it be in miles? (1mile = 1609.34m) 3) Is your double helix longer than the diameter of the Earth? 4) Is your double helix longer than the circumference of the Earth?

Save On 13 2 Manipulating DNA pages 322_323 task - Last Modified: Mon at 1:11 PM - Makama, Aisha B. MA Home Insert Draw Design Layout References Mailings Review View Help A Share 1) Develop an analogy for the processes researchers use to make changes to DNA. In your analogy, explain how it is similar to the techniques used in genetic engineering. You can draw a graphic organizer, make a table, or write a few sentences describing your analogy. 2) Devise flowchart that shows the steps to prepare DNA for gel electrophoresis, as well as the protocol for setting up and running a gel. You can add diagrams to the flowchart and add detailed notes if you like. DFocus 9:46 PM 2122/2021 135 words English (United States) Page 1 of 1 P Type here to search

Legrning Task 2: Make a.model of a DNA template to deternmine the seguence of bases in th new DNA strahds Then, answer the gulde questions that follow. Materials: crayons. Scissors, paste/tape, used folder or illustration board Procedure: Use the pattern of the DNA templater (attached to this LP). Color code, phosphate = blue, deoxyribose sugar = green, nitrogenous base as follows: adenine= yellow, thymine = pink, guanine = violet, cytosine = red. And cut the shapes of each nucleotides. Buld a model of a strand of a DNA molecule. The strand should contain 6 base" rungs" following the given order of the nucleotides: Guanine, Adenine, Cytosine, Thymine, Cytosine, Guanine. Tape the cutout pattern to form the nucieotides. This will represent the left half of DNA. Make a complementary strand that you made in step 3. Tape the cut -out pattern again forming the nucieotides for the second strand of the DNA molecules. Match the bases of the first strand and the second strand. Do not tape across…

Question Completion Status: QUESTION 25 DNA is chemically stable than RNA due to the on more: 2-hydroxyl groups: RNA more: 2'-hydroxyl groups: DNA more; 3'-hydroxyl groups: RNA less: 2'-hydroxyl groups: RNA less: 2'-hydroxyl groups: DNA

CHAPTER QUESTIONS Q1: Choose the correct answer from the following 1. What is the basis of separation of different DNA fragments by gel electre phoresis? a. The positive charge on DNA b. The size of the DNA fragments C. The sequence of the fragments d. The presence of a dye 2. Which of the following statements is accurate for DNA replication in veu cells, but not PCR? a. DNA primers are required. b. DNA polymerase is stable at high temperatures. C. Ligase is essential. d. DNTPS are necessary 3. Why is the polymerase chain reaction used? C. to ligate DNA a. to amplify DNA b. to cut'DNA d. to separate DNA 4. For what purpose is DNA fingerprinting used? a. to sequence DNA from bacteria b. to separate DNA fragments C. to identify individuals who have committed crimes d. to identify single nucleotide polymorphisms 5. Which of the following is used to cut DNA molecules in specific locations? a. cloning vectors b. cloning enzymes C. restriction enzymes d. polymerase chain reaction 6. What is…

Activity 2. You COMPLETE Me! Objective: Identify the methods used for inserting plasmids into the host cells. What you need: pen and paper What to do: On a separate sheet of paper, copy and complete the key points of the methods used to introduce plasmids into the host cells. Choose your answers from the box gene gun biolistics electric shock mammalian cells plasmid insertion by Heat Shock Treatment increase the pore sizes of their plasma membranes (2) competent plasmid DNA Heat Shock electroporation There are three methods on introducing plasmids into the host cells namely: (1)_ (3) Biolistics uses a (4)_ to fire DNA-coated pellets on plant tissues. Plasmid insertion by Heat Shock Treatment is a process wherein target cells undergo a The pretreatment is said to make the cells (6). pretreatment procedure to (5) the introduction of the (7)_ plasmid at about 4°C for about 30 minutes and the plasmids concentrate near the cells during After the pretreatment, the cells are incubated with…

Questions 17-20 A student uses restriction enzymes to cut a DNA molecule into fragments. The digested DNA is loaded into the wells of an agarose gel and the gel is subjected to an electric current. Upon completion of the run, the gel is stained. 17. The rate of migration of the DNA fragments through the agarose gel is determined by the (A) ratio of adenine to cytosine in the fragment (B) presence of hydrogen bonds between base pairs (C) length of time the electrophoresis unit is allowed to operate (D) number of nucleotides in the fragment (E) volume of the starting sample 18. Which of the following is true of the dye used to stain the fragments? (A) It increases the contrast between the agar and the DNA fragments. (B) It must be accounted for when calculating the molecular weight of the fragments. (C) Its charged areas interfere with the migration of the DNA. (D) It is bonded only to the sticky ends of the fragments and can directly determine the sequence of the DNA fragments. (E) It…

Questions 17-20 A student uses restriction enzymes to cut a DNA molecule into fragments. The digested DNA is loaded into the wells of an agarose gel and the gel is subjected to an electric current. Upon completion of the run, the gel is stained. 17. The rate of migration of the DNA fragments through the agarose gel is determined by the (A) ratio of adenine to cytosine in the fragment (B) presence of hydrogen bonds between base pairs (C) length of time the electrophoresis unit is allowed to operate (D) number of nucleotides in the fragment (E) volume of the starting sample 18. Which of the following is true of the dye used to stain the fragments? (A) It increases the contrast between the agar and the DNA fragments. (B) It must be accounted for when calculating the molecular weight of the fragments. (C) Its charged areas interfere with the migration of the DNA. (D) It is bonded only to the sticky ends of the fragments and can directly determine the sequence of the DNA fragments. (E) It…

question: Can you summarize and explain for me what you want to tell in the article below? Can you explain the figure?  When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :) Article:  Nanotechnology Tools to Detect SARS-CoV-2 Standard procedures for detecting the virus from nasopharyngeal and/or oropharyngeal swabs have been reviewed recently and are primarily based on reverse transcription polymerase chain reaction (RT-PCR). Here, we would like to mention some preliminary ideas on nanotechnology-based assays to monitor the presence of SARS-CoV-2. A simplified test and variants thereof to detect viral proteins (e.g., HIV or influenza virus) without the need for expensive equipment is based on the color change of Au NPs bound to antibodies. Similar to the enzyme-linked immunosorbent assay (ELISA) antibodies coupled…

Assignment SummaryIn this assignment, you will think of scientific questions that will help you better understand the role ofDNA and chromosomes in the expression of heritable traits in an organism. You will then conductresearch to answer these questions. Finally, you will compose a typewritten document that states yourquestions and provides your answers.Background InformationDNA in the nucleus of a cell contains the genetic code that dictates the structure and function oforganisms. DNA is compressed into structures called chromosomes. Chromosomes are made ofsegments of DNA called genes. Genes are the basic units of heredity in organisms and are transferredfrom parent to offspring.DNA contains the genetic code, or the set of instructions, in the form of triplet codons, for assemblingamino acids into proteins. All organisms share a similar genetic code based on the same DNA codons.The order of the codons differs, allowing for diversity among organisms.Not all DNA codes for proteins.…

Question (1)-Describe the three different methods of horizontal gene transfer among bacteria and mention their significance. Be specific when discussing the donor versus recipient cell, and if the donor and recipient cells are still alive after each horizontal gene transfer event is complete. *Please go into detail if possible on what the donor and recipient cells if they are still alive also after each gene transfer. I have a test coming up that I’m trying to learn all I can about this. Thank you so much!*

Please answer fast After the transfer of the F plasmid is complete     multiple choice 3 the F+ cell becomes F-. the F- cell becomes F+. F+ cell becomes antibiotic sensitive. the F+ cell expresses an R factor. the F- cell becomes HfR

I need help with some questions for my biology homework. 1. What is the difference between leading and lagging strand? 2. DNA replicated in a ______ mode 3. Transcribe and translate the DNA. Is the coding strand 5’ACCTACCCATGCTCGATAAATGAAGTTCATTTTGACAAGAC 4. How many ATPS will be used to make a protein that is 100 amino acids long 5. In a cell a certain specific gene needs to transcribed. The cell activates this genes by acetylating histone. How is this helpful in activating the gene

Question Completion Status: Which of the following experiments suggested DNA was the transforming principle? O Avery, MacLeod, and McCarty O Beadle and Tatum O Mendel O Altmann QUESTION 19 Which of the following is not true of DNA? O DNA is single stranded O DNA is double stranded DNA strands are antiparallel O DNA is composed of nucleotides QUESTION 20 What type of RNA is a part of ribosomes? TRNA O FRNA MRNA dsRNA Click Save and Submit to save and submit. Click Save All Answers to save all answers. P Type here to search 立

31_30*_SP23 - General Biology I (for m 24 ed out of nove flag evious page A $ Transcribe the following DNA: TACGGGGCTGAGATT Select one: O a. UACGGGGCUGAGAUU O b. Tyr-Gly-Ala-Glu-lle C. Met-Pro-Arg-Leu-STOP O d. AUGCCCCGACUCUAA MacBook Air

BIOTECHNOLGY Date: Name: Instructor: Section/Group:. POST-LAB QUESTIONS 1. In one or two sentences, summarize the technique of gel electrophoresis. 2. How does the process of gel electrophoresis separate DNA fragments? 3. Why is the fact that DNA has a negative charge so important in the gel electrophoresis process? Biotechnology 165

QUESTION 1 Questions 1-5. Please fill in the blank below with the corresponding structures indicated below in the diagram: Please ignore the fact that the fragments are colored blue and green. The coloration has no significance to this question. Also, please don't forget to answer question 61 1. Leading strand= 2. Lagging strand= 3. A single Okazaki fragment= 4. 3' end of fragment labeled "H"= 5. Replication fork= H E G 6. How many primers are required to replicate all of the DNA fragments in the above diagram (include both lagging and leading strand)?=

Task 2.1. Complete the table provided by comparing the Eukoryotic and Prokaryotic cel. CRITERION PROKARYOTIC CELL EUKARYOTIC CELL 1. Nucleus 2. Chromosomes 3. Lysosomes and Peroxisomes 4. Genetio Recombination 5. Microtubules 6. Endoplasmic Retioulum 7. Mitochondria 8. Cytoskeleton 9. DNA wrapping on proteins 10. Ribosomes 11. Golgi opparatus 12. Chioroplosts 13. Organ/s of locomotion 14. Cell wall 15. Vocuoles 16. Cell size

I want to know how can I make RNA transcript through next dna sequencing. 5'ATGATCTTTAAAGGGCCC 3'

URGENT Conjugate base questions

Questions:1. Why are plasmids used as vector for DNA Recombination? What other vectors can be used? 2. How are Recombinant DNA formed?3. What is the difference between genetic modification and selective breeding?

McGraw-Hi P Question 17 B. What is happening at letter "C"? O RNA Primase is laying down some RNA Primer on the lagging strand O DNA Ligase is joining two Okazaki Fragments together O DNA Polymerase III is making a new DNA strand on the leading strand O DNA Polymerase I is removing RNA Primer and replacing it with DNA on the lagging strand Ouestion 18 11 MacBook Pri B.

question: Can you summarize and explain for me what you want to tell in the article below? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :) Article: Interference with Cellular Uptake, Immobilization, and Inactivation of the Virus Outside of the Host Cell Nanomaterials can be synthesized with a high specific surface area of a few hundred square meters per gram. Therefore, dependent on the surface properties, nanomaterials efficiently adsorb biomolecules and form a so-called biomolecular corona. This passive, nontargeted adsorption might be utilized to bind viruses, provided that the selected nanomaterial is relatively biocompatible. Viral surface proteins are often modified by sugar moieties or encompass positively charged amino acid patches that bind to lectins or glycosaminoglycans (GAGs) of heparan sulfate…