DNA is chemically stable than RNA due to the on
Q: Eukaryotic cells have ___________ origins of replication along their DNA.
A: An outcome of the huge size of eukaryotic genomes is that different ( multiple ) causes of…
Q: The fragment of DNA in replication are called______fragments.
A: During DNA replication ,double helix is unwound and the complementary strands are separated with the…
Q: This happens during DNA transcription:
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: QHat is DNA
A: DNA stands for deoxyribonucleic acid. It is present in the nucleus, mitochondria and chloroplast in…
Q: A key difference between the nucleotides found in DNA andthose in RNA is thata. DNA has phosphate,…
A: Deoxy ribonucleic acid (DNA) is he genetioc material of most organisms, while ribonucleic acid (RNA)…
Q: RNA is pretty easy to make into DNA because it's single stranded , doesn't form as many structures,…
A: The first step a cell takes to read out a genetic instruction is to copy a particular nucleotide…
Q: DNA replication follows a dispersive model True or false
A: DNA replication is the process of copying already present DNA in the cell. It uses many enzymes such…
Q: A......of a DNA consists of a sugar, a phosphate, and a nitrogen containing base. A....... is a…
A: DNA stands for Deoxyribonucleic acid. It is the genetic material in humans.
Q: Chemical and Radiation Damage to DNA Can Lead to ____________.
A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…
Q: Replication of DNA begins at and transcription of RNA begins at
A: In DNA replication the double-stranded molecule of DNA is copied for making two identical DNA…
Q: The _______ strand of DNA that has the same sequence (with T's instead of Us) as the corresponding…
A: The DNA is referred to as the genetic blueprint of a cell because it contains the instructions for…
Q: Whole DNA chromosomes are kept in the nucleus while small nucleotide monomers move into and out of…
A:
Q: DNA is a large molecule and is wrapped around proteins called: O a. Histones O b. Ligase O c.…
A: DNA (deoxyribonucleic acid) is the molecule that conveys genetic information for an organism's…
Q: differentiates the DNA from RNA.
A: DNA: It stand for deoxyribonucleic acid, which is a molecule that contains the instructions an…
Q: In the DNA sequence 5'-ACTG-3', the phosphodiester linkage between the cytosine and the thymine…
A: DNA Deoxy-Ribo-Nucleic is a molecule which stores the genetic information and instructions for…
Q: Which of the following involves remarkable capacity of short segment of DNA to move from one place…
A: in order to find out the correct answer, let's analyse each option 1. transposition: DNA transposons…
Q: The _____________ strand is made continously.
A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…
Q: Errors in DNA are called mutations. what are some good and bad consequences of mutations
A: A mutation is a change in a genetic sequence. While most mutations are neutral , some can either by…
Q: If a molecule of DNA is made up of 21% adenine, there is of thymine, of guanine, and of cytosine.
A: Answer: Introduction: Rendering to the Chargaff's rules explained that a DNA by any cell of all…
Q: Histones and DNA have a strong attraction for each other because...
A: Histones are proteins that play an important role in the packing of DNA into cells, chromatin, and…
Q: The sequence of a DNA molecule also influences its melting temperature. Guanine-cytosine base pairs…
A: A molecule of DNA is a polymer of nucleotide. Each nucleotide consists of Deoxyribose sugar which is…
Q: A mutation is any change in the DNA. O True False
A: A mutation is any change on the DNA sequence that is not properly repaired. A section of nucleotides…
Q: DNA replication results in the creation of _____________ identical strands of DNA.
A: The consequence of DNA replication is two DNA molecules comprising of one new and one old chain of…
Q: An enzyme called _____________________ catalyzes theformation of a covalent phosphodiester bond…
A: DNA replication is the process of formation of complementary strands of DNA molecules from the…
Q: Biological functions of DNA
A: INTRODUCTION DNA is required for heredity, protein-coding, and delivering instructions for life and…
Q: The DNA of identical twins is an exact match.
A: Yes DNA of identical twins is an exact match and is 100% match as they are formed from the same egg…
Q: During DNA Replication, _____________ is synthesized in a series of short pieces called…
A: DNA is made up of various nucleotides that store genetic information in it. DNA is packed into a…
Q: DNA molecules can perform their function in replication and transcription as long as the hydrogen…
A: DNA is a double stranded molecule. The two strands are paired to each other by complementary base…
Q: The enzymes responsible for forming the final phosphoiester bond between two DNA fragments during…
A: The phosphodiester bonds constitute the backbone of the strands of DNA.
Q: DNA replication is bidirectional and discontinuous
A: DNA replication is a DNA dependent DNA synthetic process. DNA acts as the genetic material in the…
Q: A type of protein that associate with DNA, in Eukaryotes cell to compact the protein is Histamine.…
A: Introduction:- Watson and Crick suggested the DNA structure. They claim that DNA is a double-helical…
Q: DNA differs in composition from RNA in having deoxyribose and uracil rather than ribose and thymine.…
A: FALSE. DNA differs in composition from RNA in having deoxyribose and thymine rather than ribose and…
Q: double-stranded DNA is dissociated into
A: All organisms must replicate their DNA when cells divide. During DNA replication, an enzyme called…
Q: Which of the following is found in BOTH DNA and RNA structur
A: Nucleotides are chemical building units that makeup DNA. A phosphate group, a sugar group, and one…
Q: y the meaning of this statement: Genetic information is encoded in the DNA molecule.
A: Yes, Genetic information is encoded in the DNA molecule .It is also present in RNA molecule in some…
Q: the genetic information is coded in DNA by the the sequence of
A: The sequence of DNA bases is arranged into genes, most of which contain the instructions to create a…
Q: An enzyme that makes covalent bonds between nucleotide sequences in DNA is: O A) RNA polymeraco
A: DNA ( Deoxyribonucleic acid ) is made up of two anti parallel polynuceotide chains which coil around…
Q: Types of DNA inhibitors medicines
A: DNA inhibitors drugs are those chemical formulation that inhibit the DNA and its function.
Q: The Central dogma for biology includes: DNA to RNA which is called
A: Central Dogma is one of the most important concepts in Biology which involves the processes in which…
Q: Instead of Thymine, RNA uses O Adenine O Uracil O Cytosine O Udenine
A: There are five main nitrogenous bases two purines and three pyrimidines. Purines are adenine and…
Q: The process of making RNA (i.e. MRNA) from DNA is called Your answer
A: Transcription is generally the process in which DNA is shift to make a complete strand of RNA and…
Q: Transcription is..... dependent..... synthesis.
A: DNA/RNA
Q: If DNA segments changes from GCATAG to GCATA, this is a:
A: Mutation is a sudden, stable, and variable change in the genome of an organism. It may be due to…
Q: In 2 paragraphs. Discuss the differences between RNA and DNA, in terms of structure and function.…
A: The two important nucleic acids, DNA and RNA have some major differences based on their structure…
Q: A step-by-step process in order to alter the DNA of an organism (The five processes)
A: There are five steps involved to alter the DNA through a process named Genetic engineering. They are…
Q: meaning of this statement: Genetic information is encoded in
A:
Q: The molecule is responsible for bringing the code from DNA to the ribosome during protein synthesis.
A: Ans. The messenger RNA (mRNA), in molecular biology, is a single-stranded RNA molecule that matches…
Q: The significant of DNA replication
A: Introduction The process of replicating a double-stranded DNA molecule into two identical DNA…
Step by step
Solved in 3 steps
- Incorrect Question 9 Which of the following are essential characteristics of RNA? (Not characteristics that are typical, but ones that define RNA.) Containing a uracil (U) instead of a thymine (T) A 2'OH group Being single-stranded O Having stem-loop structures Being built of NMP monomer units. (Incoming nt is a NTP.)Question 9 The mechanism for all template-directed synthesis of any type of nucleic acid involves which of the following? A nucleophilic attack of a 3' hydroxyl toward a phosphoryl group of a nucleoside triphosphate, releasing PPi. B nucleophilic attack of a 5' hydroxyl toward a phosphoryl group of a nucleoside triphosphate, releasing PPi. nucleophilic attack of a 5' hydroxyl toward a phosphoryl group of a nucleoside triphosphate, releasing PPi. D nucleophilic attack of a 3' hydroxyl toward a phosphoryl group of a nucleoside monophosphate, releasing Pi.QUESTION 22 When double-stranded DNA is heated at neutral pH, which change does not occur? The N-glycosidic bond between the base and the pentose breaks The helical structure unwinds The absorption of ultraviolet (260 nm) light increases The viscosity of the solution decreases The hydrogen bonds between A and T break
- Question : Properties of a peptide (Indicate the right answer) : H,N-CH-CO-NH-CH-CO-NH-CH-CO-NH-CH-CO-NH-CH-CO-NH-CH-CO-NH-CH-COOH ČH3 CH2 CH, CH, HC-CH3 CH, CH2 CH2 SH CH2 CH, СООН ČH3 CH2 CH2 ОН NH, A- The sequence is Ala-Glu-Phe-Cys-Ile-Trp-Tyr. B- The sequence is Ala-Gln-Tyr-Cys-Ala-Trp-Phe. C- It is represented in its ionic form at physiologic pH. D- It possesses only 2 acid/base functions. E- All possibilities given above are wrong.Question Completion Status: Which of the following experiments suggested DNA was the transforming principle? O Avery, MacLeod, and McCarty O Beadle and Tatum O Mendel O Altmann QUESTION 19 Which of the following is not true of DNA? O DNA is single stranded O DNA is double stranded DNA strands are antiparallel O DNA is composed of nucleotides QUESTION 20 What type of RNA is a part of ribosomes? TRNA O FRNA MRNA dsRNA Click Save and Submit to save and submit. Click Save All Answers to save all answers. P Type here to search 立Question 25 If one DNA segment has the following base composition, 5-CAGTTAGTCA-3', which of the following sequences is complementary? A 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5' 3-TGACTAAСTG-5 D 5-TGACTAACTG-3'
- Question 59 FLAG QUESTION Answers A-E When comparing the mode of action of benzopyrene with ethidium bromide, one sees that both have a flat and hydrophobic structure. Both will enter the double helix of DNA and will be retained, at least in part, by the hydrophobic stacking of the bases. But the most important difference is: A Only Ethidium will color the DNA B Benzopyrene forms a covalent bond with DNA C Only Benzopyrene will form tumors D Ethidium makes DNA resist UV light) E There is a specific enzyme that removes Ethidium from DNA ● 0 O *** 0Question- Determine the exact molecular weight of the following oligonucleotide and calculate the average molecular weight of an equivalently long oligonucleotide. What is the percent error between the two? Sequence (5’-3’) : GCT TTA GCG GTC AAG TGC TGT GCC ATT T M.W. of a nucleotide in ssDNA = 303.7 + 79.0 M.W. of base pair in dsDNA = 607.4 + 158Question 33 What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 O 3- GCCTACGGGCATATG -5 O 5- GCCTACGGGCATAAG -3 O 5- GCCTACGGGCATATG -3 O 3- CGGATGCCCGTATAC -5
- Question:- Why do we need endonucleases to cut DNA if we are 60-70% water that was shown to hydrolyze phosphate bonds?Question 6 What is the complementary DNA sequence of this sequence of DNA: 5'-GTTCCCATG-3'? O 3'-GTTCCCATG-5' 3'-CAAGGGTAC-5' O 3'-CAAGGGUAC-5' O 5'-CAAGGGTAC-3' • PreviousQuestion one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the MRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar). B (Ctrl) -