Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN: 9781305389892
Author: Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15, Problem 10TYK
A part of an mRNA molecule with the sequence 5’-UGC GCA-3’ is being translated by a ribosome. The following activated tRNA molecules are available.
tRNA Anticodon Amino Acid
3’-GGC-5’ Proline
3’-CGU-5’ Alanine
3’-UGC-5’ Treonine
3’-CCG-5’ Glycine
3’-ACG-5’ Cysteine
3’-CGC-5’ Alanine
Which two of them can bind correctly to the mRNA so that a dipeptide can form?
a. cysteine–alanine
b. proline–cysteine
c. glycine–cysteine
d. alanine–alanine
e. threonine–glycine
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the
amino acid sequence that have been left blank. If several sequences might work, choose only one.
Furthermore, circle the start and the stop codons of each mRNA sequence.
1.
DNA (3'-5')
ACG
TAC
GGC
CGG
TTA
AAG
CAT
ACT
TTC
TTG
MRNA
TRNA
Amino Acid
2.
DNA (3'-5')
MRNA
AUG
ACU
AGC
UGG
GGG
UAU
UAC
UUU
UAG
AAA
TRNA
Amino Acid
3.
DNA (3'-5')
MRNA
TRNA
GCU
CCU
UAC
CAC
ССС
CGU
AUG
GCU
GGG
AUC
Activate
Go to Sett
Amino Acid
TRNAS are 'charged' or activated by aminoacyl TRNA synthetases. Select the correct statements regarding this process.
The process is dependent on interactions between ribosomes and aminoacyl TRNA synthetases.
The aminoacid is added to the D-loop of the tRNA.
Aminoacyl TRNA synthetases are pre-associated with tRNAS.
The amino acid is attached to the terminal to the 3' hydroxyl of an adenine in the acceptor arm.
The process requires an aminoacyl-adenylate intermadiate.
QUESTION 19
Select the correct statements regarding myosin-mediated contraction
the sarcomere.
O Ca2+ is required for the binding of myosin to f-actin.
Myosin and f-actin are randomly distributed in the sarcomere.
Physical pulling of the actin microfilament requires three distinct conformation changes on myosin that involve ATP binding, ATP hydrolysis and sequential
release of inorganic phosphate and ADP.
Myosin-mediated contracted is ubiquitous across all cell types.
O O O O
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
Chapter 15 Solutions
Biology: The Dynamic Science (MindTap Course List)
Ch. 15.1 - Prob. 1SBCh. 15.1 - If the codon were five bases long, how many...Ch. 15.2 - For the DNA template below, what would be the...Ch. 15.2 - Prob. 2SBCh. 15.3 - Prob. 1SBCh. 15.3 - Prob. 2SBCh. 15.4 - Prob. 1SBCh. 15.4 - Distinguish between the P, A, and E sites of the...Ch. 15.4 - Prob. 3SBCh. 15.5 - How does a missense mutation differ from a silent...
Ch. 15.5 - Prob. 2SBCh. 15.5 - Prob. 3SBCh. 15.5 - Prob. 4SBCh. 15 - Eukaryotic mRNA: usessnRNPs to cut out introns and...Ch. 15 - A segment of a strand of DNA has a base sequence...Ch. 15 - Prob. 3TYKCh. 15 - Prob. 4TYKCh. 15 - Which of the following statements is false? a. GTP...Ch. 15 - Prob. 6TYKCh. 15 - Prob. 7TYKCh. 15 - Prob. 8TYKCh. 15 - Prob. 9TYKCh. 15 - A part of an mRNA molecule with the sequence 5-UGC...Ch. 15 - Discuss Concepts A mutation occurs that alters an...Ch. 15 - Discuss Concepts The normal form of a gene...Ch. 15 - Prob. 13TYKCh. 15 - Prob. 14TYKCh. 15 - Prob. 15TYKCh. 15 - Prob. 16TYKCh. 15 - Prob. 17TYKCh. 15 - Prob. 1ITD
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-arrow_forwardGiven the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forwardA portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site Lysine Asparagine Threonine Glutamic Acidarrow_forward
- Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin. Normal Sequence Mutated Sequence DNA DNA amino acid DNA DNA amino Codon MRNA Codon MRNA coding template strand coding template strand strand acid code code strand sequence sequence G 1 1 G G C 2 A 2 A 3 G G A A 4 4 C G A G G G G 7 A 7 A G G Shape of RBC Shape of RBC 23 3.arrow_forwardA part of an MRNA molecule with the following sequence is being read by a ribosome: 5' - CCG-ACG - 3' (mRNA). The following charged transfer RNA molecules (with their anticodons shown in the 3' to 5' direction) are available. Two of them can correctly match the MRNA so that a dipeptide can form. TRNA Anticodon| Amino Acid GGC Proline Alanine Threonine CGU UGC Glycine Cysteine Alanine СCG ACG CGG The anticodon loop of the first tRNA that will complement this MRNA is Select one: a. 5'-ACG-3' b. 3'-UGC-5' O c. 5'-UGC-3' d. 5'-GGC-3' е. 3'-GGC-5'arrow_forwardConsider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letterarrow_forward
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)arrow_forwardWhich of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letterarrow_forwardUse a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…arrow_forward
- Which of the following statements is false about the structure of TRNA? O Because of hydrogen bonds, a tRNA actually twists and folds into a three- dimensional structure. O There are 4 base-paired regions and 3 loops in a tRNA molecule. O Flattened into one plane to reveal its base pairing, a tRNA molecule looks like a cloverleaf. O A TRNA molecule consists of a single RNA strand that is only about 80 nucleotides long. O A TRNA molecule carries an amino acid on its 5' end.arrow_forwardA protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter Letter phenylalanine phenylalanine serine tyrosine tyrosine cysteine cysteine U serine leucine serine stop stop A leucine serine stop tryptophan arginine G leucine proline histidine leucine proline histidine arginine leucine proline glutamine arginine arginine A leucine proline glutamine isoleucine threonine asparagine asparagine lysine serine isoleucine threonine serine A isoleucine threonine arginine methionine threonine lysine aspartate arginine valine alanine glycine glycine valine alanine aspartate C G valine alanine glutamate glycine glycine A valine alanine glutamate O Met-lle-Thr-Ala-STOP O Met-Ser-Trp-Arg-STOP O Met-Tyr-Thr-Arg-STOP O Met-Ser-Thr-Ala-STOParrow_forwardA protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter U A G Letter phenylalanine serine tyrosine cysteine U phenylalanine serine tyrosine cysteine U leucine serine stop stop A tryptophan arginine arginine leucine serine stop leucine proline histidine U leucine proline histidine leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine A isoleucine threonine lysine arginine A methionine threonine lysine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine G valine alanine glutamate glycine A valine alanine glutamate glycine G O Met-lle-Thr-Ala-STOP O Met-Ser-Thr-Ala-STOP Met-Ser-Trp-Arg-STOP Met-Tyr-Thr-Arg-STOParrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY