Biology
12th Edition
ISBN: 9780134813448
Author: Audesirk, Teresa, Gerald, Byers, Bruce E.
Publisher: Pearson,
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13.3, Problem 1TC
Summary Introduction
To explain: The way in which translated peptide differs when the guanine molecules are substituted by uracil in the mRNA sequence.
Introduction: In the substitution mutations, a single
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Give typing answer with explanation and conclusion
Which of the following statements regarding the structure and function of tRNA is true?
A-The codon / anticodon pairing is absolutely universal among organism.
B-The charging of a tRNA does not require energy.
C-There are 64 different tRNAs, one for each possible codon.
D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing
E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.
Oxytocin is a small peptide hormone.
It contains a nine amino acid sequence shown below:
CYIQNCPLG
33
How many nucleotides would be found in the mRNA for this protein?
Suggest an mRNA sequence for the peptide. Write in as 5' XXX 3' (no spaces between nucleotides). Keep
in mind, for a protein to be synthesized it needs to include a start codon and a stop codon.
Suggest a complementary template DNA sequence based on the MRNA sequences suggested above.
Write in as 3' XXX 5' (no spaces between nucleotides).
The sequence below shows the non-coding strand from the
whole of the transcribed region of a very short gene.
5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’
Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).
Chapter 13 Solutions
Biology
Ch. 13.1 - describe three types of RNA that play roles in...Ch. 13.1 - Prob. 2CYLCh. 13.1 - Prob. 3CYLCh. 13.2 - Prob. 1TCCh. 13.2 - Prob. 1CYLCh. 13.2 - Prob. 2CYLCh. 13.2 - describe an example of post-transcription...Ch. 13.3 - Prob. 1TCCh. 13.3 - Prob. 1CSCCh. 13.3 - Prob. 1CYL
Ch. 13.3 - Prob. 2CYLCh. 13.3 - Prob. 3CYLCh. 13.3 - Prob. 4CYLCh. 13.4 - Prob. 1CSCCh. 13.4 - describe three different types of mutations?Ch. 13.4 - Prob. 2CYLCh. 13.5 - Prob. 1HYEWCh. 13.5 - Envision yourself as a physician. A mother,...Ch. 13.5 - Prob. 2TCCh. 13.5 - Prob. 1CYLCh. 13.5 - Prob. 2CYLCh. 13.5 - Prob. 3CYLCh. 13.5 - Prob. 4CYLCh. 13.5 - Prob. 1CTCh. 13 - Prob. 1MCCh. 13 - Which of the following is not true of RNA? a. It...Ch. 13 - Prob. 3MCCh. 13 - Prob. 4MCCh. 13 - Prob. 5MCCh. 13 - Synthesis of RNA from the instructions in DNA is...Ch. 13 - Prob. 2FIBCh. 13 - Prob. 3FIBCh. 13 - Prob. 4FIBCh. 13 - Prob. 5FIBCh. 13 - If a nucleotide is replaced by a different...Ch. 13 - Prob. 1RQCh. 13 - Name the three types of RNA that are essential to...Ch. 13 - Prob. 3RQCh. 13 - Prob. 4RQCh. 13 - Prob. 5RQCh. 13 - Prob. 6RQCh. 13 - Prob. 7RQCh. 13 - Define mutation. Describe four different effects...Ch. 13 - Prob. 1ACCh. 13 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- TRANSLATE this RNA sequence: AUGCAAUGA Met-Gln-Stop Met-His-Stop Thr-Glu-Stop Thr-Pro-Stop What would happen if the nitrogen base second to the last of the sequence will undergo a point mutation, (G turning to A) Met-Gin-Stop Met-His-Stop Thr-Glu-Stop Thr-Pro-Stop The DNA sequence ATCAGCGCTGGC is part of a gene. how many amino acids are coded for by this message? O 4 8. 12 20 Option 5 For the lab part: how is DNA used for catching crime suspects. Describe the procedure and cite a particular example where it helped solve a case or absolved an innocent person from any wrongdoing. Your answer O Oarrow_forwardBecause of the way the genetic code structured, a point mutation in a given codon is likely to have what impact on the meaning of that codon? Select all that apply. 1.It will always change the amino acid 2.It can never change the animo acid encoded 3.The amino acid encoded often will not change 4.The biochemical property of the amino acid encoded likely will not change 5.The biochemical property of the amino acid encoded will always changearrow_forwardput in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2. Binding of large ribosomal subunit to mRNA 3. Binding of small ribosomal subunit to mRNA 4. Binding of tRNA with 2nd amino acid to the A site 5. Formation of covalent bond between methionine and second amino acid A) 1, 2, 3, 4, 5 B) 3, 1, 2, 4, 5 C) 1, 3, 2, 4, 5 D) 2, 3, 1, 4, 5 E) 3, 2, 1, 4, 5arrow_forward
- 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find enough space to do so. Once a small ribosomal subunit has bound to an mRNA, it will scan along that mRNA in the 5' to 3' direction looking for a start codon at which to initiate translation. How does the small ribosomal subunit distinguish a start codon from any other AUG codon that simply codes for methionine in the middle of a coding sequence?arrow_forwardFigure 3 represents one process that occurs during protein synthesis. amino acid molecule Q A UGC C GỤ AC C GAC Ų (a) Name the process shown. (b) Identify the molecule labelled Q. (c) In Figure 3, the first codon is AUG. Give the base sequence of the complementary DNA base sequence and the missing anticodon. Table 1 shows the base triplets that code for two amino acids. Table 1 Amino acid Encoding base triplet Aspartic acid GAC, GAU Proline CCA, CCG, CCC, CCU Aspartic acid and proline are both amino acids. (d) Describe how two amino acids differ from one another. You may use a diagram to help your description. (e) Deletion of the sixth base (G) in the sequence shown in Figure 3 would change the nature of the protein produced but substitution of the same base would not. Use the information in Table 1 and your own knowledge to explain why.arrow_forwardConsider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. 1. How many codons are represented in this oligonucleotide? 2. If the second G were changed to a C, what would be the resulting amino acidarrow_forward
- You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosomearrow_forwardUsing the given information, determine the correct order of the following events during translation: TRNA-methionine is cleaved and moves the empty tRNA to E site & is released, TRNA with polypeptide chain moves to P site. Second tRNA binds to 1. Step 1 codon in A site 2. Step 2 Ribosome arrives at stop codon & polypeptide chain is released from TRNA 3. Step 3 4. Step 4 A peptide bond is created between the first amino acid and the second amino 5. Step 5 acid. 6. Step 6 TRNA-methionine binds to the start codon and the large ribosomal unit binds Small subunit scans MRNA until it reaches start codonarrow_forwardUsing the provided coding strand below: 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the mRNAstrand for the coding strand above. Type your answer in the box below. Use two dash lines in between the 5 and your first base, and two dash line between your last base and before 3' (follow formatting above). What is your Start codon? What is your Stop codon? 5-AUGGCCGGGCCAAUAGAAUAG-3 AUGGCCGGGCCAAUAGAAUAGarrow_forward
- The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…arrow_forwardFor each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acidarrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY