Match the following sugars with their corresponding descriptions. A Esculin Arabinose aldonitol G. rhamnose K. cellobiose D. Melibiose osaccharose C. raffinose H. trehalose F. Glucose B. Lactose A. a pentose alcohol B. a disaccharide consisting of glucose and galactose units linked by B(1-4) glycosidic bond C. a trisaccharide consisting of galactose, fructose and glucose D. a disaccharide consisting of glucose and galactose units linked by a(1-6) glycosidic bond E. a disaccharide consisting of glucose and fructose linked by a1-32 glycosidic bond F, a monosaccharide under aldohexoses G. deoxymannose H. a disaccharide consisting of 2 glucose units linked by a(1-1) glycosidic bond I. glucoside of esculetin J. a monosaccharide under aldopentoses K. a disaccharide consisting of 2 glucose units linked by B(1-4) glycosidic bond

Q: 3. Look at the label for Lindt chocolate bar below. a. Does this product contain animal fat? How…

A: (a)Plants and Animals have quite a difference in theor metabolic pathways. As a result of which…

Q: Based on your knowledge of the natural amino acids, what would you expect pKa of the side chain of…

A: Succinic acid have 4 carbons, among which the two terminal carbons are carboxylic acid groups. The…

Q: Describe how will you dilute a 10X stock solution into 5X, 2X, and 1X, respectively.

A: INTRODUCTION : Diluting a Stock solution - A stock solution is a high or medium concentrated…

Q: Which energy system did you use for a vertical one-clap pushup or pushup? (Choose one) A) ATP-PC…

A: Answer ATP-PC system Explanation The ATP-PC system, also known as the phosphagen system, is the…

Q: The question stated the standard free energy change not the actual free energy change. You solved…

A: Standards free energy change calculated at biochemical standards is called biochemical standard free…

Q: 1. Explain the biochemical formation of creatinine, urea, and uric acid. 2. State the principle of…

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: 3) Which statement explains a way in which a researcher could cause a cytoplasmic protein to…

A: process of transporting cytoplasmic proteins into the nucleus 1. cytoplasmic protein contains an NLS…

Q: Describe the role of sodium and phosphomolybdate reagent in Folin Wu method.

A: NOTE : Since you have posted multiple questions, we will provide the solution only to the first…

Q: 1. Bacteria have a membrane potential, although the mechanisms of how it is maintained differ from…

A: To calculate the number of positive ions needed on the exterior surface of the bacterium to…

Q: In protein structure, which is not established via secondary interactions? o tertiary o secondary o…

A: Proteins are polymers of amino acids linked by peptide/amide bond with release of one water molecule…

Q: Draw the potential tautomers of guanine. Based on Question 1c) (i), label the patterns of hydrogen…

A: Guanine is a nucleotide base found in nucleic acids like DNA and RNA . It pairs with Cytosine with…

Q: 1. Why is it necessary to calibrate a Pasteur pipette? 2. Cite some possible sources of errors in…

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: The table below gives the initial velocities of a decarboxylase, determined at various [S], in the…

A: Km is the Michael's menton constant which can be determined as the substrate concentration at half…

Q: Calculate the expected activity for each unknown hallucinogen using the QSAR relationship that you…

A: QSAR (Quantitative Structure-Activity Relationship), is a technique used to predict the activity of…

Q: Compare and contrast Pyruvate Dehydrogenase with a-ketoglutarate dehydrogenase Outline the…

A: Enzymes are essential for the functioning of living cells and play a crucial role in maintaining…

Q: 1. Lyticase is an enzyme that breaks down cell membranes. It is particularly useful when harvesting…

A: During enzyme kinetics, the primary plot we use is the Michaelis-Menten plot with [S] as X-axis and…

Q: What is an engineered plasmid used for? What are the important features of\ engineered plasmids?

A: Engineered plasmids are powerful tools that allow researchers to manipulate DNA sequences and study…

Q: 2. Consider the following quaternary cartoon structure below, where each colored shape represents a…

A: Some proteins are composed of more than one polypeptide chain. Each polypeptide chain folds to…

Q: Standard redox potentials E' for some common compounds in biochemistry: Eo' (Volt) + 0,81 12 O2 + 2…

A: If the Gibbs free is negative for  a reaction then the process is said to be spontaneous. A positive…

Q: Calculate the pI of the following peptides: a. MASTERY b. STICKY c. DALLAS d. ART

A: the isoelectric point of a protein is the pH at which the net electric charge of that amino acid is…

Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…

A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…

Q: Draw the resonance structure of a tripeptide peptide backbone, indicating the N- and C-terminal and…

A: Peptides are molecules composed of amino acids joined together through peptide bonds. The peptide…

Q: For the reaction A + 2 B 3 C + D, what is the magnitude of the rate of change for [D] when [C] is…

A:

Q: 3. Palmitate is radiolabeled at the position using 14C. This is added to a liver homogenate. Trace…

A: Palmitate is 16 carbon fatty acid and the distant carbon is labeled as ω carbon in the fatty acid,…

Q: This SDS-PAGE loading buffer has SDS (a denaturing detergent), β-mercaptoethanol (a reducing agent),…

A: DF can be expressed as ratio of concentrations and as ratio of volumes. DF=Final volume after…

Q: On a single graph, sketch a qualitative velocity profile (velocity vs. time) for the enzymatic…

A: Activity of an enzyme is the amount of product produced per time. Relative activity of an enzyme is…

Q: A cyanobacterium absorbs 2856 photons. How many molecules of ATP are produced?

A: The process of ATP synthesis in cyanobacteria occurs through the process of photosynthesis,…

Q: Question 1 For import into the nucleus, proteins require: Ran-GTP active transport Pex5 an NES…

A: The nucleus is the compartment that is generally found in the centre of a eukaryotic cell and houses…

Q: Cell communication review

A: Cell communication refers to the process by which cells interact with each other to coordinate their…

Q: The phosphates that make up the phosphodiester bonds in DNA have pka 2. The genome of the blue crab…

A: pH is a measure of the acidity or basicity of a solution. It is defined as the negative logarithm of…

Q: serotonin,y-aminobutyric acid, and dopamine are derived from different amino acids by just one or a…

A: Neurotransmitters are chemical messengers that allow neurons (nerve cells) in the brain and other…

Q: In bacterial transforamtion, how should P+ and P- tubes look like after a successful transformation?

A: The tranformation process refers to introduction of foreign DNA in the bacteria cells. It is a type…

Q: Identify what GalNAc, GlcNAc, Frutose and Sialic Acid are, draw them and describe their…

A: Carbohydrates chemically are polyhydroxy aldehydes or ketones. They serve diverse function roles…

Q: Name of Enzyme Class Number of Enzyme Reaction Catalysed Hexokinase   Phosphorylates glucose…

A: Glycolysis is a pathway that converts glucose molecules into energy by breaking into pyruvate…

Q: 3. If PCR were performed on a highly conserved gene from two species, one prokaryotic and one…

A: A conserved gene is a gene that has remained largely unchanged over a long period of evolutionary…

Q: In the traditional alkaline lysis method of Solution 1, what is the purpose of Glucose

A: Alkaline lysis is a method for extracting DNA from cells, particularly from bacterial cells. This…

Q: 1.a)Which one of the following vitamins is fat-soluble? Vitamin B12 Vitamin D Vitamin B1 Vitamin B3…

A: Introduction Vitamins are the organic substances which is required for our growth and development.…

Q: A. Briefly discuss the four levels of structure in proteins.

A: "Since you have posted a question with multiple sub parts, we will provide the solution only to the…

Q: 5 When your body metabolizes fat for energy, it gets 9 Cal./g, as opposed to only 4 Cal./g from…

A: Adipose tissue is a type of connective tissue which comprises fat cells, or adipocytes, which store…

Q: Glycation is a process which contributes to a decreased sex drive due to increased absorption of…

A: Introduction:- The question is about the process and again what option is correct for it so frankly…

Q: 10. Briefly describe and draw the structure of these polysaccharides based on glucose or another…

A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…

Q: A carboxypeptidase is a metalloenyme (its active site contains one or more metal ions essential for…

A: An active site of an enzyme is a three dimensional structure that occurs within the enzyme. An…

Q: 13. Fill in the blanks using the keywords. +2 NADH +NAD+2 2 coenzyme A MITOCHONDRIA + CO₂ Glycolysis…

A: Introduction Glycolysis is a first step of cellular respiration. Glycolysis consists of 10 steps. In…

Q: Consider the following two peptides: I. Ile-Trp-Ala-Met and II. Glu-His-Cys-Thr Which peptide would…

A: Peptides are short chains of amino acids that are linked together by peptide bonds. Amino acids are…

Q: 21. The structure of D-arabinose is shown below. How many stereoisomers are possible for this…

A: In carbohydrates, the carbon that is attached to four different groups is called a chiral centre.…

Q: Some scientists debate whether it is correct to consider pyruvate as  “the end of glycolysis”.…

A: Introduction All living organisms require energy. They get energy from cellular respiration.…

Q: 3. A. Briefly discuss the four levels of structure in proteins. Knowing that the 3-dimensional shape…

A: Protein is a polypeptide made up of amino acids. The sequence of amino acids determines the…

Q: The hormones insulin and glucagon play an important role in the  regulation of plasma glucose. b)…

A: Insulin (release from the beta cells of pancreas) and glucagon (release from the alpha cells of…

Q: 1.c)B vitamins are involved in energy production. must be injected to be effective. are fat-soluble.…

A: B vitamins are water soluble vitamins which are of classified into 8 types. they are  Thymine ,…

Q: If the enzyme maltase has a Vo of 0.25 mM per minute when [S] = 0.10 mM, and a Vo of 0.40 mM per…

A: Enzymes kinetics - is the study of the reaction rate of enzyme catalyzed reactions. The reaction…