Standard redox potentials E' for some common compounds in biochemistry: Eo' (Volt) + 0,81 12 O2 + 2 H+ + 2 e NO3 + 2 H+ + 2 e 2 cyt c (ox) + 2 e 2 cyt b (ox) + 2 e Pyruvate + 2 H+ + 2 e NAD + 2 H+ + 2 e Acétoacétate + 2 H+ + 2 e (2) acétoacétate + NADH+H* H₂O NO₂ + H₂O 2 cyt c (red) 2 cyt b (red) Lactate (3) 2 cyt c (ox) + 2 cyt b (red) NADH + H* B-hydroxybutyrate +0,42 + 0,25 + 0,08 - 0,19 -0,32 With the help of the above table, determine the spontaneous direction of the following reactions in the standard conditions. Justify your answers by calculating the Gibbs (free) energy of reaction in each case. (1) pyruvate + B-hydroxybutyrate - 0,35 lactate + acétoacétate B-hydroxybutyrate + NAD+ 2 cyt c (red) + 2 cyt b (ox)
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: Basal Metabolic Rate (BMR) is the amount of energy your body uses to function at rest in a day. This…
A: The Total Daily Energy Expenditure (TDEE) is the amount of energy an individual burns in a day,…
Q: The radiolabel shown on the image in glycogen is used for conversion to ribose 5-phosphate while…
A: Glycogen is a polysaccharide and the storage form of carbohydrates in animals. It is a homopolymer…
Q: 1.a)High fructose corn syrup (HFCS) normally has approximately what composition? ('> means more…
A: Fructose is a simple sugar, also known as fruit sugar, that is found naturally in many fruits,…
Q: That is the lactase assay Calculate initial rate
A: Lactase assay is sensitive enzymatic method to estimate the lactose in low-lactose or lactose-free…
Q: True of false 6. In glycogen synthesis, the active form of glucose is UDPG. () 7. If people lack…
A: Glycogenesis : It is the process of synthesis of glycogen from glucose. Glycogen is a polymer of…
Q: Create a concept map connecting cancer and glycolysis (warburg effect)
A: Introduction:- The question is all about the cancerous cells that connect with Glycolysis cycle that…
Q: Question 3 A 50 kDa protein has a minimum radius 2.4nm, while a 20 kDa protein has a minimum radius…
A: 3 Answer the NPC would not allow proteins with a radius >2.5 nm to pass through freely,…
Q: You want to maintain pH-7.0 for an enzyme-catalyzed reaction that will produce hydrogen ions along…
A: Here we are undertaking a reaction that will produce hydrogen ions (H+, generally termed as protons)…
Q: Qualitative Tests for Carbohydrates: Sugar Solution Glucose Sucrose Lactose COLOR OBSERVED Molisch's…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: From the following information determine the amino acid sequence of a peptide. N-terminal Edman…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Part A. Weight of skimmed milk Isolation of Casein Weight of dried casein Percentage casein in…
A: Since you have posted multiple questions, we will provide the solution only to the specified sub…
Q: SEMINAR TOPIC Role of oxidative stress in the pathogenesis and complications of diabetes
A: Oxidative stress is caused by disparity between production and accumulation of oxygen reactive…
Q: draw the structures of the first dipeptides made in bacterial protein synthesis reactions when the…
A: The origin sequence is of 100 to 200 base pairs where replication fork begins. Specific proteins…
Q: 4. What is the net charge (approximately) on the polypeptide shown below at pH 12.5? Lys - Arg - Val…
A: Amino acids are the building blocks of proteins. The structure of amino acid consists of a central…
Q: (c) Outline how you would investigate whether BCMAP would be an effective inhibitor for the protein…
A: Inhibitors are the molecules that slow down or completely block the protein activity of molecules,…
Q: In the folded protein, His108 forms a salt bridge with Asp44. The pKa of the imidazole functional…
A: pKa is the pH at which a weak acid is 50% dissociated into H+ and conjugate base. Also, pKa = -log…
Q: What is the x-intercept for the above reaction on a Lineweaver-Burk plot? A. -0.5 per mM B. -1.0 per…
A: The Michaelis Menten equation: vo = vmax × [S]Km + [S] where vo is the initial rate of the…
Q: DNA: AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GAC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: 7. Some toxins block the synthesis of mRNA or proteins. Why would this effect be toxic, and how…
A: mRNA is the intermediate molecule between DNA and protein, carrying the genetic information encoded…
Q: Draw the structure of the a-keto acid formed by the transamination of each amino acid: (a) tyrosine…
A: Transamination is a type of reaction in which, the amino group of an amino acid is transferred as a…
Q: Formation of cholesterol "fund" in the liver.
A: Cholesterol contains 27 carbon atoms all supplied by acetyl CoA. Cholesterol has 3 six-membered…
Q: Enzymes are essential to the processes of photosynthesis and cellular respiration. Names two factors…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Compare and contrast Pyruvate Dehydrogenase with a-ketoglutarate dehydrogenase Outline the…
A: The tricarboxylic acid cycle is the metabolic pathway that generates NADH and FADH2 from the…
Q: A. Draw the structure of the following peptide sequence at pH 2.0: ASP-ALA-THR-LYS-GLY B. What is…
A: Amino acids are basic building blocks of polypeptides, and one or more of these polypeptides they…
Q: A patient was admitted to the hospital with suspicion of malaria. After the examination was complete…
A: Glucose-6-phosphate dehydrogenase (G6PD) is an enzyme involved in pentose phosphate pathway. Malaria…
Q: 1. Draw the structure of a cholesterol ester where cholesterol is esterified with palmitic acid. is…
A: The four classes of biological macromolecules are nucleic acids, proteins, lipids and carbohydrates.…
Q: n a-c below, will the residue on the right-hand side increase or decrease the pKa of the residue on…
A: Amino acids that do not have ionisable side chains are zwitterion at neutral pH since they have an…
Q: Write a scheme for the synthesis of mevalonic acid as the first stage of cholesterol synthesis.…
A: Cholesterol is a sterol found in the plasma membrane that has the characteristic steroid nucleus (4…
Q: he human body requires various nutrients which are essential for health and can be obtained from a…
A: Proteins are comprised of amino acids polymer linked by peptide/amide bonds. Fats are insoluble…
Q: The hydrolysis of ATP has an enthalpy and entropy of -24.3 kJ/mol and +21.6 J.K-1.mol-1,…
A: ATP (Adenosine Triphosphate) is an important molecule in living organisms as it provides energy for…
Q: 1. what cause the reaction of the rancid oil to ph paper to be different from that fresh oil 2.…
A: The biological macromolecules can be classified a nucleic acids, proteins, lipids and carbohydrates.…
Q: Deficiency in HGPRT will lead to what? a. No synthesis of ATP b. No salvage pathway for all purines…
A: Hypoxanthine- guanine phosphoribosyl transferase (HGPRT) is required in salvage pathway which is…
Q: Close circuit of tubes through which blood flows
A: The function of blood flow is to deliver oxygen to the different tissues and organs. Blood flow also…
Q: Glucagon facilitates the adaptation of our body to fasting. Which enzymes of glucides…
A: Glucagon is a pancreatic hormone secreted by the alpha cells of the pancreatic islets, composed of…
Q: For the electrophoresis at 25°C of two proteins, in a medium with a viscosity of 0.001kg/m-s, the…
A: Electrophoresis is a technique used in biotechnology to separate and analyze biological molecules…
Q: 1. Bacteria have a membrane potential, although the mechanisms of how it is maintained differ from…
A: To calculate the number of positive ions needed on the exterior surface of the bacterium to…
Q: The steroid progesterone has an important role in the female reproductive system. Researchers…
A: “Since you have asked multiple questions, we will answer the first and third questions. If you want…
Q: Which of the following is not a characteristic of DNA replication? O The synthesis of DNA is…
A: DNA carries all the genetic information needed to make an organism. DNA contains genes which are the…
Q: 3. Please draw the core structure of Lignan, and numbering the C-atoms.
A: In 1948, Haworth first introduced the term "Lignan", which are also subgroup of non-flavonoid…
Q: . Although, the fuel sorce can be swapped into metabolism, you need specific enzymes and coenzymes…
A: Metabolism is consist of series of biochemical reactions in living organism for the sustenance of…
Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…
A: 1. Casein is stable in a solution, at pH values close to 7. This is because at this pH casein…
Q: Please provide an example of a molecule that is soluble in water. Please explain why it is soluble…
A: The ability of a solvent to have stronger interactions with a particular solute than the interaction…
Q: 8. The amino acid sequence for the beginning of the globular protein myoglobin is:…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Part Three: Metabolism: Your cells are going to USE the food they've been provided! Describe the…
A: Metabolism is the chemical reactions occurs in our body which changes the food into energy to run…
Q: 11. Calculate the equilibrium constant for the hydrolysis of glucose-1-phosphate at 25°C AG for the…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the rate of forward…
Q: A carboxypeptidase is a metalloenyme (its active site contains one or more metal ions essential for…
A: An active site of an enzyme is a three dimensional structure that occurs within the enzyme. An…
Q: 5. Ways of cholesterol biotransformation, their tissue localization: 5.1. extracellular (LCAT) and…
A: Sterols are lipids with the characteristic steroid nucleus. The steroid nucleus is four fused rings,…
Q: 4. At pH 9.5, what is the net charge of the peptide LTDQRHGE?
A: Peptide is composed of polymer of amino acids (length of 13 to 17 amino acids) which is linked by…
Q: 1. In an individual with a nonfunctional triose phosphate isomerase (catalyzes the conversion of…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Step by step
Solved in 4 steps with 3 images
- Consider the two half-reactions below and their standard reduction potentials. NAD+ + H+ + 2e → NADH Elo= -0.32 V a-Ketoglutarate + CO₂ + 2H+ + 2e → Isocitrate E' = -0.38 V (a) What is AE" for the spontaneous redox reaction that is, the reaction that actually occurs under standard biochemical conditions (pH 7)? (b) Which of the following statements are correct under standard biochemical conditions? i. The concentration of H+ is 1.0 M. ii. The reaction NAD+ + Isocitrate → NADH + H+ + a-Ketoglutarate + CO₂ is favor- able. iii. NAD+ accepts electrons from isocitrate. iv. The NAD → NADH reaction actually occurs in reverse. The a-ketoglutarate → isocitrate reaction occurs as written. (c) Calculate AG" for the reaction in (a). (pH 7, 25°C, pressure, 1 atm.) (d) Suppose that the actual conditions are T = 25°C, pH = 7, CO₂ = 1 atm, [a-Ketoglutarate] 10 mM, [NAD+] = 2.5 mM, and [NADH] = 0.5 mM. PAR = 2 mM, [Isocitrate] DE What is the value of AG under those conditions? (Hints: pH 7 is already…Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate the K'eq of the reaction Pyruvate + NADH Lactate + NADH+H+. Note the temperature of this reaction will not affect the standard reducton potentialBegining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate the K'eq of the reaction Pyruvate + NADH Lactate + NADH+H+. Note the temperature of this reaction will not affect the standard reducton potential delta E° in the table 13-7b.
- Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate the K'eq (to one decimal point) of the reaction Pyruvate + NADH+H+ <=> Lactate + NAD+.Note the temperature of this reaction will not affect the standard reducton potential delta E'o in the table 13-7b. please provide a comprehensive explanation with each step taken.Consider the following equilibrium at 25ºC :Glucose-1-Phosphate Glucose-6-PhophateUsing the equilibrium concentrations of [Glucose-1-Phosphate] = 0.35 M and [Glucose-6-Phosphate] = 1.65 M, calculate BOTH K′eqand Gº′ for this reaction. Is this reaction exergonicor endergonic? R = 8.314 J/K·molThe standard reduction potential for ubiquione (A or coenzyme Q) is .045 V, and the standard reduciton potential (E) for FAD is -0.219 V. Using these values, show that the oxidation for FADH2 by ubiquinone theoretically liberates enough energy to drive the synthesis of ATP. Faraday constant =96.48KJ/Vol delta G' standard for ATP Synthesis is +30.5 KJ/mol R=8.314 J/mol K=1.987 cal/mol K
- Acetyl CoA + 2H* + 2e = pyruvate + COASH E = -0.48 V Ubiquinone + 2H* + 2e = Ubiquinol E" = +0.04 V Consider the redox rxn wherein a pair of e passes from pyruvate to ubiquinone. Calculate the change in standard Gibbs free energy (kJ/mol). Report answer to two decimal places.Calculate AG for this reaction under the following conditions: 37°C, pH 7, [Pyruvate] = [CO₂] = 4.0 mM, [OAA] = 2.0 mM, [ATP] = 3.5 mM, [P;] = 5.0 mM, and [ADP] = 1.8 mM. Use 2 signficant figures. AG= i kJ.mol-1 Under these conditions, the reaction is (Tolerance is +/- 2%)The reactionPyruvate-(aq) + NADH(aq) + H+(aq) → lactate-(aq) + NAD+(aq)where NAD+ is the oxidized form of nicotinamide adenine dinucleotide, occurs in muscle cells deprived of oxygen during strenuous exercise and can lead to cramp. Calculate the biological standard Gibbs energy, ΔrG⊕, for the reaction at 310 K given that the thermodynamic standard reaction Gibbsenergy ΔrGΘ = -66.6 kJ mol-1.
- Calculate the enzyme and specific activity of a reaction with 3 μM Hsp90 using the following information: The rate is measured in a spectrophotometer as 0.028 OD units/min in a 1 ml reaction volume. The absorbance was detected at 340nm and the extinction coefficient for NADH at this wavelength is 6200 L M-1 min-1 and the molecular mass of Hsp90 is 82.7 kDa. The rate of NADH utilisation is equivalent to the rate of ATP utilised by Hsp90. Show all your calculations and the units for your answers.If a 0.1 M solution of glucose 1- phosphate at 25 °C is incubated with a catalytic amount of phosphoglucomutase, the glucose 1-phosphate is transformed to glucose 6-phosphate. At equilibrium, the concentrations of the reaction components are Calculate Keq and ΔG′° for this reaction.Given the following coupled reactions: phosphoenolpyruvate + H2O → pyruvate + Pi ΔG°'= -61.9 kJ/mol ATP + H2O → ADP + Pi ΔG°'= -30.5 kJ/mol write the overall reaction, calculate the ΔG°’, and determine if the reaction is exergonic or endergonic. The overall reaction is ______ + _______ → _______ + _________ The overall ΔG°’ is ________ kJ/mol. Therefore, the reaction is _______(exergonic/endergonic)