4. Shown here is a regulation of a gene a) Is this a prokaryotic or eukaryotic gene? Explain in short b) Which of proteins A, B, or C is likely to have a DNA binding domain? c) Which of proteins A, B, or C is likely to have a transactivation domain?
Q: Which of the following Glial cells plays an important role in the formation of the…
A: Glial cells constitute all of the cells which support and assist nerve cells in their normal…
Q: 10. X X **8457227
A: The inbreeding coefficient calculates the probability that a person will receive two duplicate…
Q: . For each of the following separation methods covered in class, describe the basics of how that…
A: The question asks for a brief explanation of several separation techniques commonly used in…
Q: Which of the following is/are ways in which a single hormone can have multiple effects? There could…
A: Hormone are signal molecules that are produced by endocrine glands and bind to a specific receptor…
Q: are beta blockers contraindicated in patients with asthma and diabetes mellitus
A: When catecholamine such as epinephrine or norepinephrine binds to beta 1 and beta 2 receptors…
Q: 21) The use of Penicillin and Bacteriocins are examples of: a) Toxin-mediated killing b) Viral…
A: Penicillin is a medicine used to treatment in some infection that present in wide range in the…
Q: The following diagram shows a DNA palindrome. Supply the missing bases and use the circled base as…
A: DNA Palindrome sequence is a segment of DNA in which the nucleotide sequence on one strand reads the…
Q: PLEASE ANSWER THE QUESTION AND EXPLAIN SUCCINTLY IN 2 SENTENCES Assuming that the A1 allele is…
A: In genetics fiitness is the capacity of a particular organism to endure and procreate in a specific…
Q: Based on this picture answer the question: the family Enterobacteriaceae is represented by the and…
A: Bacteria are unicellular, microorganisms found everywhere on the planet, even in the harshest of…
Q: With pulmonary vasoconstriction resulting from increased alveolar carbon dioxide what will haopen to…
A: Blood is transported from the right ventricle of the heart to the lungs and then back to the left…
Q: 1.Explain the relationship between genotype and phenotype, and specifically describe the cellular…
A: The genotype of an organism refers to the genetic makeup or DNA sequence of the individual while the…
Q: a group of three nucleotides codes for one amino acid. these groups of three nucleotides are called…
A: Amino acids are the building blocks of proteins. They are organic compounds that contain an amino…
Q: 8. All the followings can be produced through Industrial Microbiology techniques except: a)…
A: Genetic engineering, molecular biology, and recombinant DNA technologies are all included in the…
Q: In terms of antigens and antibodies, explain why O- is considered a universal donor and why AB+ is…
A: All blood performs the same function but not all blood is created equal. Blood is divided into…
Q: In aphids, some female clones have wings and others do not. This is an example of: A) Polyphenism B)…
A: Aphids are small, soft-bodied insects that belong to the superfamily Aphidoidea, within the order…
Q: Infraction from a mandibular tooth could spread to each of the following spaces expect the... A.…
A: Infectious diseases are the diseases caused by various pathogenic microorganisms such as virus,…
Q: In the autosomal dominant/complete dominant form of the disease, in a cross between a homozygous…
A: When a single copy of a dominant gene is sufficient to manifest a specific trait or disease, the…
Q: G.H. Hardy and Wilhelm Weinberg created the Hardy-Weinberg principle, which states that a population…
A: Evolution is the process of gradual change in the inherited traits of a population over successive…
Q: at acts as The figure on the left shows four populations (black partial dispersal (grey line). Match…
A: Theory of island biogeography: According to the theory of island biogeography, the number of…
Q: 50) Genetic engineering is considered the new ___________ revolution in microbiology. a) genetic b)…
A: Genetic engineering also known as genetic modification or recombinant DNA technology involves…
Q: 7. In humans, the alleles for blood type are designated I^ (A-type blood), I ^ B (B-type blood) and…
A: ABO blood group system was discovered by Landsteiner. This system determines the blood group based…
Q: Promoter region Shine-Dalgarno sequence Kozak sequence TATAAT box TATA box GACA Unique sequence…
A: Transcription is the process by which DNA is used as a template to synthesize RNA specifically…
Q: 1.How is acid or alkaline detected in a culture medium as an end product? 1.The tests for the…
A: Biochemical tests are laboratory techniques used to identify and characterize different types of…
Q: 21. Before pollination occurs, what does an individual flower potentially have that an individual…
A: A flower is the reproductive structure of flowering plants (angiosperms) that is responsible for the…
Q: One ml of a sample was added to 99 ml of buffer. 100 µ of this was plated in nutrient agar. After…
A: A colony-forming bacterium is a microorganism that is capable of growing and dividing on a solid…
Q: 1. Match the following eight angiosperm structures to their functions. List of Structures Calyx,…
A: The largest and most diverse group of terrestrial plants on Earth are angiosperms, also referred to…
Q: Attempt E 1. 2. 3. 4. MacBook Pro Endocrine System 5. 7. 8. Submit A
A: Endocrine glands and exocrine glands are both types of glands that secrete substances in the body,…
Q: 2. List three factors that are contributing to the decline of pollinator populations. 3. From an…
A: Growing new plants from vegetative components of an existing plant, such as roots, stems, or leaves,…
Q: What will happen to the oxygen and carbon dioxide levels in a sealed container with a: a. C3 plant…
A: C3 plant: C3 plants are photosynthetic organisms that use the C3 pathway to fix carbon dioxide…
Q: Examine the karyotypes of Jacob and PAtau syndromes. List the similarities and differences between…
A: Chromosome are present in the nucleus of the cell. They are thread-like structures. These are…
Q: what are the applications of metabacording as a study of yeast in marine environments
A: Metabarcoding is a molecular approach that identifies and counts the variety of organisms present in…
Q: What is the consensus sequence that precedes a translation initiating AUG on messenger RNA? Answer…
A: The translation is the third process involved in central dogma for gene expression. It involves…
Q: How does energy movee through an ecosystem from one trophic level to the next and what is the…
A: Energy flows unidirectionally through an ecosystem. It enters the food chain through primary…
Q: Which of the following are potential uses for iPS Cells? O Development of patient specific therapies…
A: Pluripotent cells are a type of stem cell that have the ability to differentiate into any of the…
Q: Which of the following is wrong for the description of protein synthesis (A) The large ribosomal…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG…
A: In molecular biology, understanding the purpose of specific nucleotide sequences is crucial for…
Q: What is the importance of good quality of sleep?
A: Good quality sleep is crucial for physical, mental and emotional health. It allows the body to…
Q: In an experiment that tested eye muscle reaction time based on a physical stimulus, 12 subjects were…
A: The amount of time it takes for the eye muscles to react to a visual stimulus is known as the eye…
Q: What is injected into the body in COVID-19 vaccines such as Pfizer and Moderna? And how are these…
A: The Pfizer and Moderna COVID-19 vaccines are mRNA vaccines which contain a small piece of genetic…
Q: Which of the following is true about natural selection? It can only act on traits that are heritable…
A: Evolution is a steady phenomenon that bring about alteration in life form from simple to more…
Q: Identify the base labeled B. cytosine thymine O adenine O guanine A C B D
A: Nucleotides are the building blocks of DNA and RNA. Nucleotide is composed of a sugar, phosphate and…
Q: what are the factors affecting yeast diversity in marine environment and factors affecting seaweed…
A: Areas, where the reconciliation is done to conserve biodiversity and its sustainable use, are called…
Q: for the species : wood pecker provide the following information: 1. Species name/common name…
A: Species name/common name: The species name of woodpecker is Picidae, which belongs to the family…
Q: Show the cross between a heterozygous purple flowered pea plant and a white flowered pea plant. What…
A: Alleles are different versions of the same gene that can exist in a population. Each individual…
Q: Q5 Neanderthal Did the neanderthal and modern human range overlap at any point in time? Is there…
A: Neanderthals (Homo neanderthalensis) are the archaic humans that are the closest extinct relatives…
Q: Which of the following conclusions is supported by the diagram and the data table? Number of cell…
A: The animal kingdom is the largest kingdom amongst the five kingdoms consisting of all animals.…
Q: The junctional imprecision resulting from the random insertion or deletion of nucleotides to the cut…
A: V(D)J recombination is a process of genetic rearrangement that occurs during the development of…
Q: Which of the MHC pathways is activated by phagocytosis of extracellular particles? O Class I MHC O…
A: The MHC (major histocompatibility complex) system plays a critical role in the adaptive immune…
Q: A mutation in the coding region of a gene may alter the of the gene. protein-coding region may alter…
A: Mutations are changes in the DNA sequence of an organisms genome. DNA is the genetic material that…
Q: Arial ▼ 3' 5' 11 + 2 B IU A Ο 1 1 3 A. Which strand is the "leading strand"? B. Which strand is the…
A: The lagging strand is synthesized in the 3' to 5' direction during DNA replication. This is the…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 3 steps
- 1. (a) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to sup- press synthesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix - reverse turn - helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein. A diagram of the trp repressor dimer is also shown. Trp Prl Trp Prl 80 -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly-Ile- -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr-Val- trp helix 5 70 trp helix 4 Prl helix 80 Prl helix Ala-Thr-Ile-Thr-Arg-Gly-Ser-Asn-Ser-Leu-Lys-Ala-Ala- Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- reverse turn 90 Comparing the two protein sequences above, identify all amino acid pairs that differ in electrostatic charge due to proton dissociable groups (assume pH 7). Indicate the charge of both residues for each such pair. (b) Circle the pair of residues for which the electrostatic charge due to…1. true or false a) Capping is the process of adding poly-guanido methyl in the mRNA. (true/false) b) In a nucleosome (histone-DNA structure), the histone is highly positively charged. (true/false) c) The presence of lactose in E.coli triggers the transcription of Lactose Operon.a) State the functions of the subunits of RNA polymerase and describe transcription initiation. b)Draw a diagram to illustrate the lac operon and explain how it functions in the presence of, i) glucose and ii) lactose in the culture medium
- Match the following terms related to transcription in eukaryotes (you may use terms more than once or not at all) A) RNA Polymerase I, B) RNA Polymerase II, C) RNA Polymerase III, D) All 3 RNA Polymerases E) None of the above 1. Driven only by downstream promoter elements __________ 2. Promoter contains TATA box __________ 3. rRNA __________ 4. tRNA __________ 5. mRNA __________ 6. snRNA __________ 7. A second class of promoters contains CAAT box 100-200 nucleotides from the start site of transcription __________ 8. Synthesize RNA 5’ to 3’ __________ 9. Synthesizes RNA 3’ to 5’ __________ 10. Very sensitive to α-amanitin __________16. During early life many infants receive milk from the mother. One of the major components of milk is lactose. a) Consider the Lac operon in E. coli, and state what the expression of Lac Y would be in I) E. coli WT (wild type, everything is functional) and II) E. coli whose lacl gene has been delet- ed, when each of the 2 strains are growing in culture flasks that contain high glucose and high lactose. Hint: choose among 'high expression; low expression; no expression'for I) and II). 1) II) b) In the graph below, draw the expression of LacY over time in strains I and II, when each of the 2 strains are growing in culture flasks that contain high glucose and high lactose, as shown in part a). Hint: you can draw the curves on a piece of paper and copy and paste a picture of it, if it is difficult to draw the graph directly here. If you do so and you have a Mac, make sure to convert your exam into PDF by doing "Print > Save as PDF"; do not “Export as PDF". time (min) Make sure to label…Using the transcription unit diagrammed below, in which exons are represented by blue boxes and introns are represented by the connecting lines. You discover a single base deletion in region E of this DNA sequence. Regarding transcription, this mutation will likely: 1.) Result in an alteration to the mRNA sequence. 2.)Have no effect on transcription or the mRNA sequence 3.)Prevent transcription at the TATAA box 4.) Result in an increase or decrease in the amount of mRNA transcribed
- 1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner and also induce conformational changes in the DNA. Describe the purpose of thses two modes of interaction with the DNA. 2. Draw the structures of the amino acid side chains that correspond to the following histone modification: a) acetylation of lysine; b) phosphorylation of serine; c) phosphorylation of histidine. How do thses modifications change the character of their respective side chain?Regarding the process of gene transcription in eukaryotes, it is correct to state that A)The transcription process is terminated when the RNA polymerase complex reaches the final region of the gene with the poly-adenylation signal. B)The RNA polymerase II transcription elongation complex contains transcription factors such as the TATA box binding protein C)The opening of the region of DNA that will be transcribed is done by the DNA helicase, present in the transcription complex. D)The main function of the Mediator coactivator is to promote the transition between elongation and completion of the transcription process. E)Different activators and repressors can influence the transcriptional elongation complex by binding to the promoter regions of genes7) Which of the following needs to occur for transcription to take place in prokaryotes? A) The RNA polymerase must recognize the promotor sites that typically occur upstream of the start of transcription at approximately -35 and -10 base pairs. B) The sigma factor protein must be absent for RNA polymerase to bind to the promotor site. C) An enhancer site must be activated upstream of the promotor site. D) Molecules outside the nucleus must trigger transcription factors located on the DNA. X X X XX Homologous chromosomes can line up in two ways during metaphase of mesosial 1000 8) The image above demonstrates A) linked genes X B) the principle of independent assortment C) the central dogma of molecular biology D) the law of dominance XX X 9) Which of the following statements is true? A) A recessive trait will never be the most common phenotype in a population, regardless of environment. CB Dominant traits are always the most common phenotype in a population, regardless of environment.…
- a) what is a promoter and give the element and their functions of E.coli promoter b) what are eukaryotic transcription factor and list the class 2 general transcription factors and state their functions(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helixMany bacterial genes with related functions are arranged in operons, sets of contiguous genes that are under the control of a single promoter and are transcribed together. (a) What is the advantage of this arrangement? (b) How might eukaryotic cells, which do not contain operons, ensure the simultaneous transcription of different genes?